This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RATT annotation transfer tool usage.

Dear all,

First of all this is not a question. I have tried to run RATT tool over a week, and finally I managed to run and received results. I am writing here that If anyone needs help about usage of RATT from generating embl file of each scaffold in an assembly to installation of RATT and usage, I can help.

I would like to thank Alex Reynolds, cpad0112 and Juke-34 for their help.

assembly genome sequence gene

Perhaps most useful would be to write a tutorial on how to use it - and post that here as a tutorial.

A tutorial would be fantastic. I'm struggling with this program, currently.

OK. I will do as soon as possible.

Please let me know where you are having problems while you are running RATT.

Dear Mehmet, Could you tell us, have you finished manual for RATT? Unfortunately, i have some problems with RATT usage. Thanks

Sorry for being late. Could you please let me know at which point you need help? At least I can do this until I complete tutorial.

Hello Mehmet, I am late to this thread, but would appreciate some guidance please if you are able to help. I have spent the whole day trying to get this software running after installing PAGIT locally and also using EMBLmyGFF3 to build .embl from augustus output. I try to run this script:

start.ratt.sh ./EMBL query.fa MR_H Assembly reference.fa

and get this error, which is a listed warning in the RATT documentation.

I am using the reference.fa. Please make sure that the description line of each fasta entry is the same than in the embl file name!

I believe that my files comply. Here is an example of the head of my .embl

XXX; XXX; linear; genomic DNA; XXX; XXX; 124273364 BP.

XX

AC XXX;

XX

AC * _APSI_P001

XX

PR Project:PRJEB1234;

XX

and the fasta

APSI_P001 ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCAATGTAATCTATATGAAAA ATTAGATTTTTAATGAATTTTATAATATATCTCATATGAAAAAACTTTCACAATGTAATTCAATGAAAAA AATATTTTTCAATACAATTCATATTGAAAATACGTATTTTTAGTGTAGTTTATATTGAAACTGCATTTTC

Many thanks in advance of your anticipated help.

Hi Peri,

Sorry for my late reply. Can you try this?

  ./start.ratt.sh embl_files_directory/ New.genome.fa old2new Assembly

0 answers

No answers yet.

Log in to answer this question.