I was a bit confused by the output of a bwa read-alignment. I have observations that return a good CIGAR value but poor MAPQ value. This alignment was obtained from converting a BAM file -> BED file that was generated with bwa mem.
chr1 142536052 142536087 336_1362_95 0 - 16 35M * 0 0 CACTCCAGACTCGGTGACAGAGTGAGATCCTGTCG 8?@?.:/@@@@@@@@@@@@@@@>?@@@@?@@>@=@ NM:i:1 MD:Z:8T26 AS:i:30 XS:i:29
I thought CIGAR values and MAPQ value should be correlated but this breaks my intuition. Any insights would be super helpful. Thanks!
•
written
by
cpak1981
1 answer
The cigar string tells you how well the alignment matches the reference. That doesn't mean the nucleotide match, but that's not the point here.
The mapping quality tells you how likely this location is indeed the correct location for this read. A read matching perfectly to a repetitive element will have a low mapping quality because you are unsure about its exact location, it's a multi-mapping read.
I just blatted your sequence and it's clear that this is part of an Alu element and therefore occurs very often in the genome.
Log in to answer this question.
-
Bwa mem different alignment results for the same reference genome
written by EarthShaker-EAC •
-
BWA MEM Multiple Primary Alignments
written by Lawrence •
-
Bowtie2 alignment scores seem less than the actual value
written by Sina •
-
MAPQ (Mapping quality) of 0 for most reads from BWA-MEM2 (with no secondary alignment or other app…
written by artemd •
-
BWA alignment score calculation
written by Donovan •
-
Bizarre CIGAR string
written by 2nelly
-
bowtie2 '-a' does not return all alignments
written by shim •
-
some unrelated info in SAM file generated by BWA
written by zhangdengwei
-
bwa-0.7.12 AS:i and XS:i match but MAPQ = 0
written by suzanne.mcgaugh
-
reads mapped in proper pair (99/147) but mapq=0 ?
written by Pierre Lindenbaum
