I have two paired end reads generated by illumina..there is an error when trying to run SSAKE with these reads..

ERROR:

=>Reading sequences initiated Wed Jul 12 14:19:40 IST 2017 Input error at line #1: The sequence "@1/2" is not in the right format for paired-end reads -- Fatal Make sure your input is in the form (input sequences can be of variable lengths):

>test
GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT

Where : separates paired reads. Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.

QUESTION: so how can i prepare the input fasta file for paired end reads in SSAKE assembly tool look like this

Paired reads must be separated by ":"

>template_name:200
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:GCGCACGACGCAGCACAGCAGCAGACGAC

Is there any inbuilt program file located in SSAKE 'OR' other outside program?_____________________________________________________________________________________________