Hello everyone,
I would like to ask anyone who know about How to use result from GeneMark-ES program to identify function? For now I already have a result like below of this post. And It's include Nucleotide sequences output but I would like to use Amino acid sequences to identify function. That's the problem that I would like to ask suggestion by anyone who know to solve this problem. I cannot translate those Nucleotide sequence to Amino acid sequence because It's still include intron when just translate Nucleotide sequence to Amino acid sequence.
Output from GeneMark-ES : *Eukariotyc GeneMark.hmm version 3.49 Sequence name: /storage/home/nuthatai.sut/CallORF_Tool/gm_et_linux_64/gmes_petap/output/data/dna.fa_15 FASTA defline: >dna.fa_15 15_dna 1 30316 Sequence length: 30316 bp G+C content: 27.92% Matrices file: /storage/home/nuthatai.sut/CallORF_Tool/gm_et_linux_64/gmes_petap/output/gmhmm.mod Tue Oct 25 17:52:02 2016 Predicted genes/exons Gene Exon Strand Exon Exon Range Exon Start/End # # Type Length Frame 1 2 - Terminal 6981 7014 34 3 3 - - 1 1 - Initial 7171 7244 74 2 1 - - 2 2 - Terminal 16420 16424 5 3 2 - - 2 1 - Initial 16476 16509 34 1 1 - - 3 1 + Initial 26431 26436 6 1 3 - - 3 2 + Terminal 26642 26644 3 1 3 - -
nucleotide sequence of predicted genes
gene_1|GeneMark.hmm|108_nt ATGTCATCCCTTACTTTGCATCAACAGGCCTACTACACGATAGCACCCGCCGGAATGTCC ATTTGGACTGAACGTAAGAAAGGCGACGTCATGACCAAGACAGTATAA gene_2|GeneMark.hmm|39_nt ATGTTTCTACCAAACATCGGATTTAACTCACCAGGATGA gene_3|GeneMark.hmm|9_nt ATGAATTGA
end nucleotide sequence*
Thank you for advance everyone
2 answers
This is an old question, but I had the same problem. So here is how I solved it:
Edit the GTF file from genemark:
cut -d" " -f1,4- genemark.gtf | sed -e 's/ /\t/' | cut -f 1,3- > genemark_corrected.gtf
Obtain the protein sequence from the assembled contigs. Mine were from MEGAHIT:
get_sequence_from_GTF.pl genemark_corrected.gtf assembled_contigs.fa
The Perl script is found in the same folder as the other genemark scripts, e.g. gmes_linux_64/, where gmes_petap.pl is found.
Bless your soul, I saw that the genemark.gtf file didn't work with get_sequence_from_GTF.pl and you have saved me an untold amount of time with this solution.
Hello Ian, I hope this message finds you well. I have edited the genemark.gtf file as you suggested. However, the resulting .gtf file appears to be flawed, as it continuously repeats the name of my organism throughout the file. As a result, I was unable to successfully utilize the Perl script. Could you kindly advise on how you might assist me in resolving this issue?
Log in to answer this question.
-
How to Detect Amino Acid Changes from a GATK VCF File and Reference Genome Using Code?
written by DareDevil
-
GeneMark-ES output with error about perl module
written by katak •
-
Replace Ambigious codons with Amino acid sequences
written by waqaskhokhar999
-
GeneMarkS-2 Output Metadata
written by spence.lank •
-
How accurate is UniProt?
written by alexille5640 •
-
Incorrect scaffold names GeneMark-ES
written by alastair.j.lud •
-
Eukaryotic gene prediction using GeneMark-ES
written by lakhujanivijay
-
Extract amino acid sequence (with fasta header) from FGENESH tool : Python
written by nut_B •
-
Blasting using Blastx (nucleotide sequence as input) versus Blastp (translated necleotide sequence …
written by drsbalaji •
-
Terminology for "amino acid frame"
written by bravetang8 •
blastxit on NCBI's site...? https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthomeAnd be aware, GeneMark only predicts CDS sequences. There's no guarantee that actually is one - and if I'm reading your copied sequences correctly, GeneMark thinks it found 3 that are 108nt or less? I'd say its pretty unlikely that anything that short codes for something meaningful.
I have another CDs predictor that another tool have Amino acid sequence. That's reason why I would like to convert GeneMark-ES output to Amino acid sequences. And I would like to thank you for your help, if you have any suggestion please let's me know.
Thank you
If you just need a tool that does translation for you, use ExPASy: http://web.expasy.org/translate/
Again, note that this is not an exact science for unknown organisms, you'll be relying on a generic version of whatever translation table you choose which may not be exactly right for your organism - whatever it is.
Thank you for your suggestion.