Thank you very much :)
• 0 views
•
link
Hello,
Could everyone help me about How to extract amino acid (with fasta header) from FGENESH prediction tool?
The Output of FGENESH like this:
*FGENESH 4.0.0 Prediction of potential genes in Fusarium/Pezizomycotina genomic DNA
Time : Tue Oct 11 18:40:21 2016
Seq name: unitig_0|quiver|quiver
Length of sequence: 6684005
Number of predicted genes 1593: in +chain 768, in -chain 825.
Number of predicted exons 5989: in +chain 2949, in -chain 3040.
Positions of predicted genes and exons: Variant 1 from 1, Score:106181.523438
G Str Feature Start End Score ORF Len
1 - PolA 7273 3.25
1 - 1 CDSl 7320 - 7345 2.65 7320 - 7343 24
1 - 2 CDSi 7381 - 7399 2.20 7382 - 7399 18
1 - 3 CDSi 7478 - 7493 8.21 7478 - 7492 15
1 - 4 CDSf 7627 - 7655 -7.12 7629 - 7655 27
1 - TSS 8189 0.28
2 + TSS 15941 -2.21
2 + 1 CDSf 16356 - 16371 -2.72 16356 - 16370 15
2 + 2 CDSi 16722 - 16727 2.95 16724 - 16726 3
2 + 3 CDSi 16786 - 16796 6.44 16788 - 16796 9
2 + 4 CDSi 17219 - 17227 5.40 17219 - 17227 9
2 + 5 CDSl 17495 - 17500 8.90 17495 - 17500 6
2 + PolA 17534 3.25
Predicted protein(s):
>FGENESH:[mRNA] 1 4 exon (s) 7320 - 7655 90 bp, chain -
atggcagggtggctaacgggaagtgttaggatagagttaacgttgaaaagagcaagctat
aattttagcgcgcaggtattgtacaagtaa
>FGENESH: 1 4 exon (s) 7320 - 7655 29 aa, chain -
MAGWLTGSVRIELTLKRASYNFSAQVLYK
>FGENESH:[mRNA] 2 5 exon (s) 16356 - 17500 48 bp, chain +
atgaataagcgtaaaatgaaaggcaaaaatattctaaaaacggcataa
>FGENESH: 2 5 exon (s) 16356 - 17500 15 aa, chain +
MNKRKMKGKNILKTA*
But I would like to extract only amino acid with some position such as; I would like to get only amino acid (in position 16356-17500) and amino acid sequence. Like this:
>FGENESH: 2 5 exon (s) 16356 - 17500 15 aa, chain +
MNKRKMKGKNILKTA
Could anyone can suggest me in python script?
Thank you advance,
grep line starting with '>' and print one line After the match
grep '^>' -A 1--no-group-separator input.txt
Log in to answer this question.