This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimming TruSeq Universal Adapter (Trimmomatic)

As you can see here, I have done Fastqc on my fastq. The reads have a 125 nucleotides length.

There is no overrepresented sequence even if I can see there are Universal TrueSeq Adaptators at the end . 1- Is this insignificant ? Do you think I need to remove them ?

I'd like to try to remove this adaptators using Trimmomatic or (fastqX toolkit or cutadapt) I don't want to be too stringent specifying a given length..First I really want to remove this specific adaptator at the end of my read.

2- By the way, what is the accepted cutoff by community for filtering by quality, Qqual 30 or less ? Given the quality picture above, what kind of threshold would you use ? using Qqual or ReadLength ? Personnaly, I was thinking to use Qual 20 or 115 for readLength/

In trimmomatic you can remove ILLUMINACLIP:TruSeq3-PE or ILLUMINACLIP:TruSeq2-PE depending on the library used. You can configure yourself a file with your adaptors. I read stuffs here and here about Illumina adaptators but i'm not sure about the sequence to use.

So does someone has already remove Universal TrueSeq Adaptators in Trimmomatic ? What would you use as sequence Adaptator ? and is this really necessary to remove this adaptators knowing that an Extensive Evaluation of Read Trimming Effects on Illumina NGS Data Analysis

Thanks

fastq trimming rna-seq trimmomatic
• 25,134 views • link
updated by Nanderson-coder • Nanderson-coder • written by ZheFrench ZheFrench

Universal Illumina adapters Paired Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

• 0 views • link
written by Nanderson-coder • Nanderson-coder

3 answers

First off, I would always recommend trimming adapters; they are never beneficial for any analysis. Second - if you download the BBMap package, you can use /bbmap/resources/adapters.fa which includes all standard Illumina adapters. Lastly, if you use BBDuk as in this post, you will get much more accurate adapter-trimming compared to Trimmomatic; and it's faster as well.

• 0 views • link
written by Brian Bushnell Brian Bushnell

In that case, look in the FastQC adapter sequences file, see what sequence they call TruSeq Universal Adapter.

• 0 views • link
written by mastal511 mastal511

I was just looking at this for a sample where FASTQC reported lots of the Illumina Universal Adapter present. Looking in the files included with FASTQC, this is defined in Configuration/adapter_list.txt (under the conda opt folder if you use conda), and says:

Illumina Universal Adapter                  AGATCGGAAGAG
Illumina Small RNA 3' Adapter               TGGAATTCTCGG
Illumina Small RNA 5' Adapter               GATCGTCGGACT
Nextera Transposase Sequence                CTGTCTCTTATA
SOLID Small RNA Adapter                     CGCCTTGGCCGT

So, we made a tiny FASTA file containing this,

>Illumina_Universal_Adapter (copied from FastQC data files)
AGATCGGAAGAG

and told trimmomatic to use this as the adapters file.

• 1 views • link
written by Peter Peter

Adapter trimming is more important for some applications than others. It's more important if you plan to do de novo assembly, for example.

Trimmomatic comes with adapter files for TruSeqv2, TruSeqv3, or Nextera, so as long as you know what version of adapter sequences was used in the library prep, you don't have to make your own adapters file.

• 0 views • link
written by mastal511 mastal511

Yeah but the problem is that I don't know what version of adapter sequences was used. I have just the information in the fastq resume saying it's "TruSeq Universal Adapter"...

• 0 views • link
written by ZheFrench ZheFrench

Log in to answer this question.

More posts like this