Adapter Removal regardless posistion
Hello everyone,
I am having trouble removing adapters for some smallRNA-seq data. it seems that I am getting reads that only contain the adapter followed by a lot of A. I have tried using cutadapt, but it seems to look for adapters in either end of the read, but if it finds it in the 5' end it leaves what follows the adapter. Trimmomatic had similar results than cutadapt in 3' adapter mode.
Is there any software to remove everything that follows the adapter, regardless of what end it is in?
Thanks in advance
• 2,862 views
•
link
1 answer
I suggest using BBDuk from the BBMap package:
bbduk.sh -Xmx1g in=reads.fq out=clean.fq ref=adapters.fa ktrim=r k=23 mink=11 hdist=1 minlen=16
or if the above is your actual adapter sequence:
bbduk.sh -Xmx1g in=reads.fq out=clean.fq literal=ATCTCGTATGCCGTCTTCTGCTTG ktrim=r k=23 mink=11 hdist=1 minlen=16
• 0 views
•
link
Log in to answer this question.
I'm pretty sure that trimmomatic should remove everything to the 3' side of the adapter sequence, so it should remove the entire read if the read starts with the adapter. Do you have single-end or paired-end reads, and what is the command you are using?
Single end, I just ran Trimmomatic with the command ILLUMINACLIP:adapter.fa:2:30:10, and I still get 3 million of this sequence ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAA, which it has the adapter on the 5' end
Which version of the adapter fasta files are you using, and Is that adapter sequence in your adapter fasta file?
I am using a custom adapter file, and also the adapter I am using in the file is ATCTCGTATGCC
I think what is happening is that the length of the adapter sequence in your adapter.fa is not enough to exceed the threshold score for simple trimming (10 according to the parameters Illuminaclip:adapter.fa:2:30:10).
If you look at the trimmomatic web page, or the manual, it says that each matching base adds just over 0.6 to the score for recognising a match to the adapter. If your adapter is 12 bp long, a perfect match will only score 0.6X12=7.2, which is less than 10, so trimmomatic will not treat that as a sufficient match to the adapter. Either lower the threshold score or increase the length of the adapter sequence in the adapter fasta.
You were right, Thank you very much! :)