This is a test version of Biostars. For the public version, visit https://www.biostars.org.
awk to clip off telomeres

I want to use the Mac OSX terminal to clip repetitive sequences from the beginning of the each sequence in a fasta file. For example, I would like to make the following file:

>seq1
CCCCAAAACCCCATGATCATGGATC
>seq2
CCCCAAAACCCCATGGCATCATTCA
>seq3
CCCCAAAACCCCATGTTGCTACTAG

become:

 >seq1
ATGATCATGGATC
>seq2
ATGGCATCATTCA
>seq3
ATGTTGCTACTAG

by clipping off the CCCCAAAACCCC at the beginning of each sequence. Is there a way I can do this in the OSX terminal?

osx terminal awk telomere fasta
• 3,249 views • link
updated by Farbod Farbod • written by rm16 • rm16

That seems pretty handy. Thank you for the tip. I'll try it out.

• 1 views • link
written by rm16 • rm16

3 answers

This seems like more of a sed query than an awk one. Specific solution to your query below:

sed -e 's/^CCCCAAAACCCC//g' inputfile.txt > outputfile.txt

(This removes the sequence of CCCCAAAACCCC from the beginning of any line).

The general solution (which I imagine is what you really want) is harder because you need to set criteria for what the sequence can comprise... For example, if you just wanted to strip the first 12 n'tides from your sequences the following would work:

sed -e 's/^[A,C,T,G]\{12\}//g' inputfile.txt > outputfile.txt

...but I imagine that is too simplistic?

Either way, you should check out sed substitutions and regular expressions.

• 1 views • link
updated by GouthamAtla GouthamAtla • written by coleman_jonathan coleman_jonathan

That sounds like a good starting place. I think I can adapt this. Thanks a lot!

• 1 views • link
written by rm16 • rm16

Hi ,

have you tried BioAwk ?

https://github.com/lh3/bioawk

• 1 views • link
written by Farbod Farbod

You can also try SeqKit, usage of subseq

Subseq from 13th to last base (-1):

seqkit subseq -r 13:-1 seq.fa > out.fa
• 1 views • link
written by shenwei356 shenwei356

Log in to answer this question.

More posts like this