This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Should I trim adapter for single-end RNASeq reads?

In my knowledge, it is necessary to check and trim adapters for paired-end RNASeq reads because some inserts might be too short and that leads to adapters being sequenced into reads. But for single end, it seems not necessary because there is no way to sequence to adapter. Is this right?

rna-seq
• 2,800 views • link
updated by Devon Ryan Devon Ryan • written by ddzhangzz ddzhangzz

1 answer

You're just as likely to sequence into the adapter with SE reads as PE reads. If you're doing end-to-end alignment then you really need to trim adapters (with local alignment it's not so important).

• 1 views • link
written by Devon Ryan Devon Ryan

Thanks @Devon. The sequencing center gave me two adapter sequences:

>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Adapter_Index_1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

I am wondering why there are two adapters and which one should I use as to trim off?

• 1 views • link
written by ddzhangzz ddzhangzz

Use one of the standard trimming programs (trimmomatic, bbduk.sh from BBMap). BBMap includes a file with common adapters. You don't need to worry about selecting a specific one.

• 1 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this