This is a test version of Biostars. For the public version, visit https://www.biostars.org.
DOOR2 (operon predictor) does not load my fna file, do you know an alternative software?

I am trying to predict operons in a genome of interest using DOOR2 pipeline http://csbl.bmb.uga.edu/DOOR/annotate.php . When I load my files to send to the server, I get the following message: "Please specify the fna file." The problem is that I am sending an fna file downloaded from Genbank. I have tried to contact the authors, but I have gotten no response.

Do you know what could be wrong? Do you know alternative softwares for operon prediction?

Regards.

door2

Can you post a few lines of the file?

The link in your post is broken.

>LN831776.1 Paenibacillus riograndensis SBR5 genome assembly SBR5(T), chromosome : I
GTGGACAGCCATACTTCCGAATTATGGCAGCAAATTTTATCGATTATTCAAACCAAATTAAGCAAGCCGAGCTTTGATAC
CTGGTTTAAAGCAACGAAGGCGCTTACCTTCAGCCCCCAGGCCCTGATTATCTCGGCGCCTACAACCTTTGCTGTAGAAT
GGCTGGAAAGTCGTTATACCAAATTGGTAGGAGCTACGGTTTATGAAGTGACCGGAGAGCAAGTTGAGGTCAAGTTTGTG
ATTGAGGAGAATAAGCCGGCCGAGCCGGTCGTGCAGCAAACGGCCCCTTCCCCAGCGGTATCGCGTGAAGAAGCGCAGAC
CCATTTGCTCAATCCCAAGTACACTTTCGATACGTTCGTCATCGGTTCCGGCAACCGTTTTGCGCATGCAGCCTCACTGG
CTGTGGCAGAAGCGCCGGCAAAGGCTTATAACCCTCTGTTTTTATACGGTGGCGTAGGATTAGGCAAAACTCATTTGATG
CACGCGATCGGACATTATGTGCTGGAGCACAACCCTAATAATAAGGTCATTTACATCTCGTCCGAGAAGTTTACGAATGA
GTTCATCAACTCCATCCGTGACAACCGCGGTGAAAGCTTCCGCAACAAGTACCGCAATGTTGACATATTGCTCATTGACG
ACATTCAATTCCTCGCCGGCAAGGAGTCAACACAGGAGGAATTTTTCCATACGTTCAACGCTTTGCATGAAGAGCGCAAG
CAAATTATTATCTCGAGCGACCGTCCCCCAAAGGAAATTCCCACATTGGAAGAACGGCTGCGCTCCCGGTTTGAATGGGG

I have fixed the link.

Hi, I'm facing the same problem with DOOR2. Would you please mind to share how you fixed the problem? Thank you.

Using the example files at the site a job appears to be running (have no idea how long this takes). Will update this post if I get results back.

Yes. I have already tried it. It works. I believe there is a bug related to fna size, because if I reduce it, it seems to work....

Their example file is ~103 Kb and your sequence above is ~8 Mb. Largest genome in the ready made database in DOOR appears to be ~12 Mb so in theory large genomes are doable (perhaps not via the web).

Is there any the difference between this P. riograndensis SBR5 genome sequence and the one annotated and available in Ensembl Bacteria? I know one can find the annotation of operons in some of the bacterial genomes in that database, (e.g. lacZYA in E. coli MG1655). Not sure if that has been done for your species of interest though.

Yes. It is the same sequence and annotation. Unfortunately there is no annotation of operons in this genome.

Yes. But the size seems to be the problem..

1 answer

A google search seems to suggest the following: proOpDB, this Biostars post, FGENESB. This is the search results.

I have already tried googling. Unfortunately these search results are not adequate for my problem.

I see. It seemed to me that for some of them (e.g. FGENESB) you could input a sequence and get the prediction of the operons. Others (e.g. Operon and MicrobesOnline) seem to have operons predicted for Paenibacillus sp (not P. riograndensis) but that could be a starting point (followed by BLAST search against your species) in case DOOR keeps throwing the message you had. Alternatively send the authors another reminder.

Log in to answer this question.