Hi all

I do rna-seq , after tophat mapping, I got 6 aligned.bam file . And I played them by Cuffdiff, it works. However, if I try Htseq-count on 6 aligned.bam file (I have sorted and transfer it to SAM), one of them have error and hence I cannot get the counts table.

The error is

Error occured when processing SAM input (line 4241616 of file aligned_sn.sam): ("Malformed SAM line: RNAME == '*' although flag bit &0x0004 cleared", 'line 4241616 of file aligned_sn.sam') [Exception type: ValueError, raised in _HTSeq.pyx:1294]

I check the line 4241616 of SAM file, it is

B500959:23:HW5G2BGXX:1:21303:20052:4160        0       *       411525  50      22M1949N18M     *       0       0       AAAGAATCAAGAGCTGCAGCGGGCAAGGCAGAGAGAGAAG        AAAAAEEEEE6EEEEAEEEEEEEE/EE<EEEEAEEEEEEE    AS:i:0  XM:i:2  XO:i:0  XG:i:0  MD:Z:0G18T20    NM:i:2  XS:A:+  NH:i:1

I don't know why does it happen because it is first time I have this error, I am very confused. I know RNAME == '*' means an unmapped segment without coordinate.

Now I want to know (1)Why does it happen? (2)What will I do?

Thank you!