I am attempting doing variant-calling on a genomic sample, however it failed at the SortSam step due to the following:
Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Tag of type i should have signed decimal value; File HBCC-DNA-CER-13309.sam; Line 124767604
Line: E00218:353:HC32YALXX:5:2212:7395:55227 83 chr20 27310902 0 151M = 27310664 -389 GAGCGCTTTCAGGACGACGGTGAAAATGGAAATATCTTCCAAGAAAATCTGGATAGAAGCAATGTCAGAAACTTTTCTGTGATGGATCTACTCAGCTAACAGAGTTGAACCTTTCTTTTGAGAGAGCAGTTTTGCAACACTCTTTTTGTGG ?=<7>@@@??@>>>9>>9>>>>???>>>6??>?=>??>>>??>???>>>>===>>=>>==>=====>=>>=>>>>=>==========>>=>==>=>>>==>=>=>=<>===>>=>=>=<==<=<==<==>=>===>===>=>>>>??=><> NM:i:1 MD:Z:50A100 AS:i
I'm not familiar with this issue. How do I resolve it?
genome
sort sam
sam
picard
How was this sam file generated?
It was generated using bwa mem.