Biostar Beta. Not for public use.
SortSam is failing due to Error Parsing SAM file: ("Tag of type i should have signed decimal value")
0
Entering edit mode
14 months ago

I am attempting doing variant-calling on a genomic sample, however it failed at the SortSam step due to the following:

Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Tag of type i should have signed decimal value; File HBCC-DNA-CER-13309.sam; Line 124767604

Line: E00218:353:HC32YALXX:5:2212:7395:55227    83  chr20   27310902    0   151M    =   27310664    -389    GAGCGCTTTCAGGACGACGGTGAAAATGGAAATATCTTCCAAGAAAATCTGGATAGAAGCAATGTCAGAAACTTTTCTGTGATGGATCTACTCAGCTAACAGAGTTGAACCTTTCTTTTGAGAGAGCAGTTTTGCAACACTCTTTTTGTGG ?=<7>@@@??@>>>9>>9>>>>???>>>6??>?=>??>>>??>???>>>>===>>=>>==>=====>=>>=>>>>=>==========>>=>==>=>>>==>=>=>=<>===>>=>=>=<==<=<==<==>=>===>===>=>>>>??=><> NM:i:1  MD:Z:50A100 AS:i

I'm not familiar with this issue. How do I resolve it?

ADD COMMENTlink
0
Entering edit mode

How was this sam file generated?

ADD REPLYlink
0
Entering edit mode

It was generated using bwa mem.

ADD REPLYlink
1
Entering edit mode
13 months ago
France/Nantes/Institut du Thorax - INSE…

use the parameter : VALIDATION_STRINGENCY=LENIENT

or just use

samtools sort
ADD COMMENTlink
1
Entering edit mode

This may fix it. But looking at the record posted by the OP, the AS tag doesn't have an associated value, which is odd and maybe should be investigated. Maybe the file is corrupted...?

ADD REPLYlink
0
Entering edit mode

what is the version of bwa mem ? how was the bam file post-processed ?

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1