im a student learning perl
I have a DNA sequence in a scalar and have already performed the reverse function, now I want to get the compliment by using tr in perl, I'm getting a syntax error.
my $seq = "CCTCACACGCCCTGTTCTGGTGTCTGGTCGGATGTGTTGGTCGTGCGCAGATTGGTGCTC";
my $revseq = reverse $seq;
print "$revseq";
my $compseq = if($revseq =~ tr/ATCG/TAGC/){
print "$compseq";
then after I get the reverse compliment I have to get the RNA seq by using TR to replace T with U.
The hard part is I have a text file with codons and need to translate my RNA sequence into a protein. Any suggestions?
3 answers
Edit: Notes:
- Make sure to remove any non-word characters from your input
- To get range characters of a string, check out the substr function:
perldoc -f substr, you could also useunpackto split the string into an array of triplets, and use array functions. substring will be faster most likely, array function will be more readable. You can find different ways of exactly your problem by searching stackoverflow. - You do only need to reverse complement, if you want to translate the reverse strand. CDS are noted in the correct direction, such that they can be translated directly.
- Make a genetic code table for standard genetic code including stop codons, store it in a hash, use the three letter codon as the hash key
- If the codon is not covered in the code table, you can output X for unknown sequence, e.g. if the input contains Ns
Pitfalls (you could argue this can never happen ;)> :
- String IO, did you treat line breaks correctly? Do you want to have a certain input output format, e.g. Fasta?
- How do you treat unknown characters, e.g. N, most genomes contain N, capital vs. non-caps?
- A lot of sequences contain IUPAC ambiguity symbols in DNA, sometimes, the AA sequence can be uniquely recovered, even if the codon contains ambiguity
- which frame do you want to translate? Could there be an offset at the start of the sequence? What if the sequence length is not multiple of 3?
- What do you do if there is no start or stop codon in the sequence?
- there are many different genetic codes, standard is often ok, but not always
My only other advice here is, unless this is just for learning perl, and exercise, or you understand exactly all the pitfalls, please do not re-implement a heavily tested and debugged existing piece of code. If this is part of a research project, you should use either the tool EMBOSS transeq, or the BioPerl/Libraries which also have a translate function, see http://www.bioperl.org/wiki/HOWTO:Beginners#Translating.
It is not trivial to specify and implement such a simple at first glance problem as translation, it turns out there are more potential pitfalls than first expected.
To make clearer what I mean, from the documentation of Transeq 6.6.0.0:
History Written 4 March 1999 - Gary Williams July 2001 - changed definition of reverse frames to use the same codon phase as forward frames. - Gary Williams
This program has been used to translate billions of sequences since it was written, it is hard to imagine that there is a special case of input that it could not handle or a bug that has not been discovered until now.
This looks like a practice problem taken from Rosalind. They give very basic bioinformatic problems that can be solved using your choice of programming language. I don't think he's actually trying to re-create any software.
Sure, that's why i wrote "unless this is just for learning perl, and exercise", of course that is totally fine for learning. OP can compare the output of the self made tool with these tools to check if everything is ok.
what is the syntax error you are getting?
there may be a function in one of the BioPerl packages to transform your RNA sequence to protein.
ive resolved the error. could anyone help with how to . Get three nucleotides at a time (a codon) from each sequence until it is not possible to get another codon. Get the single letter amino acid code for each codon and add it to a scalar which contains the final translated sequence. Print the two final protein sequences. i have the codons and the proteins in a separate file
Dear,
Just a small remark, for your variable $compseq,if you want to use the if clause, than first initiate your variable:
my $compseq; if(...){$compseq = ...;} else {$compseq = .... ;} print $compseq."\n";
or use a ternary operator if you directly want to asign a value.
That being said, make sure you try your script on variety of outputs many times before you release it. Make sure there are no errors or the user is informed properly of the error. I am totally happy that you are reinventing the wheel. If no one reinvents the wheel, we will soon run out of people who can even remember what a wheel was. Keep up the good work,
Regards,
PS: I do have a code for what you are asking in the above comment, but first try to come up with your own solution.
im confused as to the logic of how to perform the translation task any hints or help ?
There are many different styles to achieve it, here is the logical flow of one: First initate a hash where you keep your codons and their correspoinding amino acid such as: my %degenerate_code = ("A" => ["GCT","GCC","GCA","GCG","Nonpolar"],....) then split the the mRNA/cDNA by "" (empty string) and store it in an array. Now loop through this array with 3 offset values (i=0 or i=1 or i=2; because you have 3 possible frames), at each step combine 3 consecutive letters and search through the hash (using grep) to find the amino acid, once found store in an other array or combine as string. Do the whole loop for the 3 aforementioned offset values. You will get 3 possible candidates.
Using the codons as hash keys would be much more efficient: %gencode = (AUG => 'M', ...). The search for hash complexity for hash key lookup is O(1) and also more clean to write the lookup. You can find ready-to-copy-paste tables e.g. https://bioperl.wordpress.com/2011/04/14/genetic-code-perl-hash/ here. Make sure to double check that they are correct.
A ready solution to cheat is here http://www.perlmonks.org/?node_id=94263,
note that the translation is by a single regex replace where %g is the code table s/.{1,3}/$g{$&}/g, this was a code golf to make the shortest (aka. most unreadable obfuscated code). This solution came out fastest while others could reduce the code length to 123 characters including the code table.
Log in to answer this question.
Btw.: your code is a fragment only and this is the error I get:
You can't use an if statement as right-hand value of an assignment in Perl, the following should be slightly more safe:
the sequence its returning is shorter than the original ?
No, why?
your correct sorry. how would I Get three nucleotides at a time (a codon) from each sequence until it is not possible to get another codon. Get the single letter amino acid code for each codon and add it to a scalar which contains the final translated sequence. i have the codons in a text file
So, as you are trying to learn how to do it, I will show you some steps that you could try and which documentation to read, and not a full solution, I will also list things that can go wrong. Please check my answer.