This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Local Blast: Querying A Single Sequence Without Input File. Possible ?

Hi,

When using BLASTALL by command line, is there any way of querying BLASTALL without using any input file but a directly a sequence ?

I would like to do something like:

blastall -n blastn -d MyBud.fna -XX "ATCGTTAGCT"

Thx for your help

blast
• 13,201 views • link
updated by jwhabig • jwhabig • written by Pasta • Pasta

3 answers

no, but you can provide your sequence via stdin:

echo -e ">Name\nATCGTTAGCT" | blastall -n blastn -d MyBud.fna

i Query File [File In]

default = stdin

The query should be in FASTA format. If multiple FASTA entries are in the input file, all queries will be searched.

• 430 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Perfect! That will do the trick. Thanks for your help

• 0 views • link
written by Pasta • Pasta

Just an add (because I just tried it on a server): if your interpreter is sh (not bash), then you need not the use of "-e" (which does not exist in sh anyway).

• 0 views • link
written by Manu Prestat Manu Prestat

Just an add (because I just tried it on a server): if your interpreter is csh (not bash or sh), then you need not the use of "-e" which does not exist in csh anyway.

• 0 views • link
written by Manu Prestat Manu Prestat

Another tip, the new blast+ suite takes bash subprocesses, so, you could even do:

blastn -query <(echo -e ">Name\nATCGTTAGCT") -subject <(echo -e ">Name\nATCGTTAGCT")

etc...

• 225 views • link
written by Sujai Kumar Sujai Kumar

This is very useful. Note that process substitution is invoked by bash, not shell. So if use this in Perl, you can do something like this:

my $seq1=">seq1\\nTGAAAGATGG";
my $seq2=">seq2\\nTGAAAGATGG";
my $line="blastn -subject <(echo -e \"$seq1\") -query <(echo -e \"$seq2\") -outfmt 6";
my $result=qx(bash -c '$line');
print "$result\n";

Hope it helps!

• 0 views • link
written by shujun.ou.1 • shujun.ou.1

blastn -subject <(echo -e \"$seq1\") -query <(echo -e \"$seq2\") -outfmt 6

for this command how it can be run in python , if you know please reply asap. if i want to put directly Sequence in place of $seq2 , how it is possible

because i am trying this command in python but getting this error

Warning: (1431.1) CFastaReader: Ignoring invalid residue " at line 1, position 0 Warning: (1431.1) CFastaReader: Ignoring invalid residue " at line 1, position 78

• 0 views • link
written by devengsbtm • devengsbtm

I was interested in performing the same operation from within python and thought I'd share an example of my implementation in case it is valuable to anyone else in the same boat.

import subprocess

blastn = subprocess.Popen('blastn -db PVY -outfmt 6', shell=True, stdin=subprocess.PIPE,stdout=subprocess.PIPE, stderr=subprocess.STDOUT)

results, err = blastn.communicate('AAATTAAAACAACTCAATACAACATAAGAAAATCAACGCAAAAACACTCACAAAAGCTTTC')

• 258 views • link
written by jwhabig • jwhabig

Log in to answer this question.

More posts like this