More posts like this
-
creating virtual library preparation of all possible exons in a gene in human
written by harry 4Hi everyone, I want to make a virtual library fasta file for all the possible exons in a gene and also all possible exon-intron fasta …
-
Blast against P450 database
written by huiyus97 1Hi, I want to perform a blast using local P450 database, however, I can't find any fasta file contains all P450 sequences. Can someone please …
-
Reverse Complement of each coding regions
written by the_cowa 4I have a fasta file which contains coding sequences as like this >Seq1 ATGAATGACAAAATTAA GTTATATTTAAA TCCTTAATAACTTACCAGAAGAGACTAATGA CATCTCATGCCATGAAG I need to find Reverse Complement of each …
-
change a mitochondria genome genebank file to a fasta file including multiple fasta sequence
written by HZZ0036 3Hi, I have a mitochondria genome file and the format is genebank. I want to change it to fasta format including multiple fasta sequences. When …
-
FASTA sequence sorting based on the header
written by Eva_Maria 19Hello I have a Fasta file which contains more than 10 lakh sequences example >lcl|DS180868.1_cds_EDM56185.1_1 [protein=putative lipopolysaccharide biosynthesis glycosyltransferase] [protein_id=EDM56185.1] [location=complement(116..658)] TCAGCAAACGGTCTCAGACAATGCGATTATCACCATTAAAGGCACACCGACAAAAGCTGGTGAATCTGGTGCAGCACTTA based on the …
-
Reduce FASTA file name
written by Eva_Maria 19I have more than 60000 fasta file and which having long name like BA000031.2_ID=gene0_Name=VP0001_gbkey=Gene_gene=VP0001_gene_biotype=protein_coding.fasta BA000031.2_ID=gene8_Name=VP0009_gbkey=Gene_gene=VP0009_gene_biotype=protein_coding.fasta and I want to change like this VP0001.fasta VP0009.fasta like …
-
finding gene variation using Fasta files
written by Eva_Maria 19Hi I have 50 genes and I want to find each genes variation(SNPs) in 400 genomes. All genes and genomes are in fasta format only. …
-
extract sequences from a fasta file and save into different files
written by Eva_Maria 19Hey I have a fasta file which contains more than 80 sequences. I want to take each sequences in different files and the file name …
-
unique sequence IDs from fasta file
written by tcf.hcdg 7Dears I have a fasta sequence file which have some duplicate sequences in it. I want to remove all the duplicates from the file and …
-
Identify restriction sites of a cDNA sequence using a dictionary
written by albamaria.muniesa 0<p>Hi.</p> <p>I need to identify restriction sites of a cDNA sequence in a fasta file. First, I transform the sequence from FASTA to a string …
Duplicate: Convert multiple-sequence fasta file to single long sequence
Please search the forum before you post.