concatenate sequences in a fasta file

I have a fasta file which contains 7 sequences . i want to concatenate all 7 ...how it possible

sequence alignment

• 8,521 views • link

written 10.6 years ago by Eva_Maria

Duplicate: Convert multiple-sequence fasta file to single long sequence

• 0 views • link

updated 6.6 years ago by Ram

• written 10.6 years ago by GouthamAtla

Please search the forum before you post.

• 1 views • link

written 10.6 years ago by Ram

0 answers

No answers yet.

More posts like this

creating virtual library preparation of all possible exons in a gene in human
written 5.5 years ago by harry •

Hi everyone, I want to make a virtual library fasta file for all the possible exons in a gene and also all possible exon-intron fasta …
Reverse Complement of each coding regions
written 6.1 years ago by the_cowa •

I have a fasta file which contains coding sequences as like this >Seq1 ATGAATGACAAAATTAA GTTATATTTAAA TCCTTAATAACTTACCAGAAGAGACTAATGA CATCTCATGCCATGAAG I need to find Reverse Complement of each …
change a mitochondria genome genebank file to a fasta file including multiple fasta sequence
written 9.0 years ago by HZZ0036 •

Hi, I have a mitochondria genome file and the format is genebank. I want to change it to fasta format including multiple fasta sequences. When …
FASTA sequence sorting based on the header
written 9.7 years ago by Eva_Maria

Hello I have a Fasta file which contains more than 10 lakh sequences example >lcl|DS180868.1_cds_EDM56185.1_1 [protein=putative lipopolysaccharide biosynthesis glycosyltransferase] [protein_id=EDM56185.1] [location=complement(116..658)] TCAGCAAACGGTCTCAGACAATGCGATTATCACCATTAAAGGCACACCGACAAAAGCTGGTGAATCTGGTGCAGCACTTA based on the …
Reduce FASTA file name
written 10.5 years ago by Eva_Maria

I have more than 60000 fasta file and which having long name like BA000031.2_ID=gene0_Name=VP0001_gbkey=Gene_gene=VP0001_gene_biotype=protein_coding.fasta BA000031.2_ID=gene8_Name=VP0009_gbkey=Gene_gene=VP0009_gene_biotype=protein_coding.fasta and I want to change like this VP0001.fasta VP0009.fasta like …
finding gene variation using Fasta files
written 10.6 years ago by Eva_Maria

Hi I have 50 genes and I want to find each genes variation(SNPs) in 400 genomes. All genes and genomes are in fasta format only. …
extract sequences from a fasta file and save into different files
written 10.6 years ago by Eva_Maria

Hey I have a fasta file which contains more than 80 sequences. I want to take each sequences in different files and the file name …
snp and copy number of variation detection
written 10.6 years ago by Eva_Maria

In blast output file (fasta format) how to find all SNPs and copy number of variations . which tool is suits for doing this
unique sequence IDs from fasta file
written 11.0 years ago by tcf.hcdg

Dears I have a fasta sequence file which have some duplicate sequences in it. I want to remove all the duplicates from the file and …
Identify restriction sites of a cDNA sequence using a dictionary
written 12.0 years ago by albamaria.muniesa •

Hi. I need to identify restriction sites of a cDNA sequence in a fasta file. First, I transform the sequence from FASTA to a string …