This is a test version of Biostars. For the public version, visit https://www.biostars.org.
unique sequence IDs from fasta file

Dears

I have a fasta sequence file which have some duplicate sequences in it. I want to remove all the duplicates from the file and secondly I wanted to stored these duplicate sequence in another file.

Please guide how can it be possible

Thanks

fasta grep
• 8,748 views • link
updated by Ram Ram • written by tcf.hcdg tcf.hcdg

It's not clear from your post: are you wanting to find duplicate sequences or duplicate sequence identifiers? In other words, which of the two lines do you want to check for duplicates in the set below:

>GeneHeader
AAGTCAGCTGATGCTACGAC
• 0 views • link
updated by Ram Ram • written by Dan D Dan D

I want to find duplicate sequence identifiers.

• 0 views • link
written by tcf.hcdg tcf.hcdg

OK, so you want to remove any duplicated sequence identifiers and their corresponding sequence information from the FASTA file. Then you want to output those duplicated identifiers to a separate file. Each sequence identifier would only be shown one time, regardless of how many times it's duplicated in the FASTA data. Is that correct?

• 0 views • link
updated by Ram Ram • written by Dan D Dan D

yes absolutely right

• 0 views • link
written by tcf.hcdg tcf.hcdg

1 answer 

$ cat *.fa* | grep '^>' | sort | uniq -d

This will print all duplicate entries. You can then use this list to extract the duplicate sequences from the file with one of the thousand fasta-manipulation-tools available.

• 0 views • link
updated by Ram Ram • written by kloetzl kloetzl

After getting uniq identifiers, here is what to do.

• 0 views • link
updated by Ram Ram • written by venu venu

Log in to answer this question.

More posts like this