This is a test version of Biostars. For the public version, visit https://www.biostars.org.
extract sequences from a fasta file and save into different files

Hey I have a fasta file which contains more than 80 sequences. I want to take each sequences in different files and the file name should be header of corresponding sequence.

perl sequence awk fasta
• 4,514 views • link
updated by Ram Ram • written by Eva_Maria Eva_Maria

That's simple but the header should not contain illegal characters for a filename i.e. \ / : * ? " < > |

a simple loop will do that if one takes care of these chars.

• 0 views • link
updated by Ram Ram • written by Naren Naren

yup header like this only GCF_000196095n.fasta_2 ..

• 0 views • link
updated by Ram Ram • written by Eva_Maria Eva_Maria

3 answers 

$ pip install pyfaidx
$ faidx --split-files in.fasta
• 0 views • link
updated by Ram Ram • written by Matt Shirley Matt Shirley

http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/seqretsplit.html

seqretsplit <input_fasta>
• 0 views • link
updated by Ram Ram • written by HG HG 
curl https://raw.githubusercontent.com/gouthamatla/fasta_File_Manipulation/master/SplitFastaFile.py | python - <in.fasta>
• 0 views • link
updated by Ram Ram • written by GouthamAtla GouthamAtla

thank u sir... its working

• 0 views • link
updated by Ram Ram • written by Eva_Maria Eva_Maria

Log in to answer this question.

More posts like this
  • Remove truncated sequences from multifasta file.
    written by Saroha • Saroha
    I have some multifasta files. Each file contains **mixture of Complete and truncated sequences**. I want that if more than one variant of any sequence …
  • To do blastp iteratively using terminal script
    written by sinumolg • sinumolg
    I have one input file containing 200 fasta query sequence. I want to do standalone blast for each fasta sequence separately . I am expecting …
  • FASTA sequence sorting based on the header
    written by Eva_Maria Eva_Maria
    Hello I have a Fasta file which contains more than 10 lakh sequences example >lcl|DS180868.1_cds_EDM56185.1_1 [protein=putative lipopolysaccharide biosynthesis glycosyltransferase] [protein_id=EDM56185.1] [location=complement(116..658)] TCAGCAAACGGTCTCAGACAATGCGATTATCACCATTAAAGGCACACCGACAAAAGCTGGTGAATCTGGTGCAGCACTTA based on the …
  • Compairng multiple sequence and finding similarity.
    written by EVR EVR
    HI, I have two fasta files with same seqnames but with slightly different sequence names like follows: File_1 >trinity5_comp_3_0_1 TTATGCATAT >trinity5_comp_9735_1_5 AAAATGATGA >trinity5_comp_645_0_2 TCGAATGCGA >trinity5_comp_3169_0_1 …
  • Reduce FASTA file name
    written by Eva_Maria Eva_Maria
    I have more than 60000 fasta file and which having long name like BA000031.2_ID=gene0_Name=VP0001_gbkey=Gene_gene=VP0001_gene_biotype=protein_coding.fasta BA000031.2_ID=gene8_Name=VP0009_gbkey=Gene_gene=VP0009_gene_biotype=protein_coding.fasta and I want to change like this VP0001.fasta VP0009.fasta like …
  • Fasta sequence replacement based on header name
    written by seta seta
    Hi everybody, I have two fasta file with two kinds of header format, I want to replace sequences of interest in one file based on …
  • Append sequence based on sequence ID
    written by venu venu
    Hello, I've 2 directories containing more than 8000 protein fasta sequence files each. Both directories contain some sequence files (ids only, not the sequence present …
  • Frequency of a unique sequence in a fasta file
    written by Tanvir Ahamed Tanvir Ahamed
    Hi, I have a FASTA file containing sequences with id as header . The header for all sequence are unique but some sequences are similar …
  • find similar sequences between different sources
    written by sam • sam
    Hello, I have different sets of sequences from different sources (e.g. I have around 20 fasta files (each fasta file correspond to one source) where …
  • Appending Identifiers To The Fasta Header: Multiple Files
    written by himanshu17 • himanshu17
    <p>Hi,</p> <p>I have a collection of 200 bacterial genome sequences with each file corresponding to separate bacterial species. The names of the sequence files are …