Hi
I have a made variant callings of a bam file. Now instead of checking 100 variants one by one in a genome browser (such as IGV) and making screenshots, I am wondering if there is any software that allows me to create an alignment plot of a defined region.
Let's say I am looking for something that works similarly to:
imaginary-alignment-plot-software --input my.bam --chr 7 --start 5000 --end 7000 #etc....
Thanks for any pointers!
Cheers
I wrote a
•
written
by
Pierre Lindenbaum
Hello Pierre-- very useful application. thank you. Is there a way to control aesthetics of the svg? ie sample name, coordinates, grey banding in background? Thanks!
You can use samtools tview in order to visualize aligned reads spanning a specific position in you sorted bam.
samtools tview [-p chr:pos] [-s STR] [-d display] <in.sorted.bam> [ref.fasta]
If -d is set to T you can visualize output as text alignment file. As example:
47696431 47696441 47696451 47696461 47696471 47696481 47696491
AATCCCCAGTCTTTGCCTTGCACAAACCTATATGCCCGTTGACTCTCTGGGGTGGGGAAAAAAAAAGTCATATTTAAGGT
................................................................................
,,,,,,,,,,,,,,,,, ,,,,,,,,,,,,,,,,,,,,,,,, ,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
................................................................................
................................................................................
...................................A............................................
...................................A............................................
................................................................................
................................................................................
................................................................................
................................................................................
...................................A............................................
...................................A............................................
................................................................................
................................................................................
................................................................................
Take a look at this for further information.
•
written
by
Nicola Casiraghi
Log in to answer this question.
