This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What is the meaning of 'Error running 'prep_reads'?

Hi friends,

I was running the tophat2 but I got error. Do you know the reason please?

[izadi@lbox161 bowtie2-2.2.5]$ $TOP/tophat2 -p 8 -G genes.gtf -o /usr/data/nfs6/izadi/angel/ouput genome SRR1944942_trimmed_unmapped.fastq
[2015-09-05 14:38:53] Beginning TopHat run (v2.1.0)
-----------------------------------------------
[2015-09-05 14:38:53] Checking for Bowtie
          Bowtie version:     2.2.5.0
[2015-09-05 14:38:53] Checking for Bowtie index files (genome)..
[2015-09-05 14:38:53] Checking for reference FASTA file
[2015-09-05 14:38:53] Generating SAM header for genome
[2015-09-05 14:38:53] Reading known junctions from GTF file
[2015-09-05 14:38:53] Preparing reads
    [FAILED]
Error running 'prep_reads'
Error: beginning of quality values record not found! (@@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@)
tophat2 bowtie2
• 3,503 views • link
updated by Ram Ram • written by zizigolu zizigolu

What have you explored, How do you interpret the error message ?

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Sorry Pierre, actually I don't know

I tried

[izadi@lbox161 bowtie2-2.2.5]$ grep -A4 @@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@ SRR1944942_trimmed_unmapped.fastq
@@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@
@SRR1944942.3556091 H134:111:COBYJACXX:2:1107:2281:140117 length=50
CACTCTTCCAGTTTGATTGACTCCTTGAGTTCTGCCGTTCAAGGTTTGGT
+SRR1944942.3556091 H134:111:COBYJACXX:2:1107:2281:140117 length=50
CCCFFFFFHHHFHIIJJJJJJJJJJJJIJJIIJJJJJGIIIIIJHIJJJJ

but the same error

then I tried

[izadi@lbox161 bowtie2-2.2.5]$ cat SRR1944936_trimmed_unmapped.fastq | paste - - - - | awk ' $1 ~ /^@HWI/ && $3 ~/^+/' | sed 's/\t/\n/g' > QC_filtered.fastq

Again the same error. If possible may you please tell me the reason?

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

Pierre,

I tried with original fastq (without adapter trimming) then worked but I don't the reason yet. Does this mean that the adapter trimming cause this error?

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

1 answer

In which line number does the erroneous quality string occur?

grep -n '@@?ADDDDBFHFH@FHBC:CIGEEHAC@FGDD?BDFGHGHEIIIDHEFC@' SRR1944942_trimmed_unmapped.fastq

Is the line number a multiple of 4?

• 0 views • link
updated by Ram Ram • written by piet piet

Sorry I can't get you. I used these codes from biostars and I can't interpret them

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu

Do you understand what the command is doing and why piet asked whether the resulting number is a multiple of 4?

• 0 views • link
updated by Ram Ram • written by Devon Ryan Devon Ryan

No Devon I could not. May you tell me please

• 0 views • link
updated by Ram Ram • written by zizigolu zizigolu 
man grep

Then describe the fastq format.

• 0 views • link
updated by Ram Ram • written by Devon Ryan Devon Ryan

Log in to answer this question.

More posts like this
  • Error in Bowtie2
    written by rasoulfarzaneh • rasoulfarzaneh
    Hi The script I have is tophat -p 4 --b2-very-sensitive -G '/home/rasoul/Desktop/Data/ngs/genome/annotation.gtf' /Home/rasoul/Desktop/Data/ngs/genome/genome '/Home/rasoul/Desktop/Data/ngs/SRR941816/keep16.gz' Error [2020-04-05 18:15:48] Beginning TopHat run (v2.1.1) ----------------------------------------------- [2020-04-05 18:15:48] Checking …
  • error in tophat2
    written by zizigolu zizigolu
    hi, I have already built index for genome fasta by **bowtie2-build genome.fa aspergillus.fumigatus** but I don't know why tophat can't find them :( [izadi@lbox200 bowtie2-2.2.9]$ …
  • Error running bowtie: .. (When I use tophat2)
    written by leenaehyeon • leenaehyeon
    Hi I was install bowtie2 (`apt-get install bowtie`, `bowtie2`, `samtools`) and version is /usr/bin/bowtie2-align version 2.1.0 I ran tophat2 for RNA-seq mapping, but this error …
  • Error: segment-based junction search failed with err =127
    written by leenaehyeon • leenaehyeon
    tophat2 mapping error I always use this command and mapping is successfully end. tophat -o tophat_out_sample -G hg19_genes.gtf --transcriptome-index hg19_transcripts --library-type fr-firststrand hg19 Sample_1_bbduk.fastq Sample_2_bbduk.fastq …
  • error in bowtie2 alignment
    written by zizigolu zizigolu
    Hey friends, For months I'm working with bowtie2 but today I am getting error My reference genome fasta is in bowtie2 folder, I indexed the …
  • failed to transcriptom indexing with tophat2
    written by zizigolu zizigolu
    Sorry guys, Please some one help me to know why I face with error whenever I'm trying this syntax? ``` [izadi@lbox161 bowtie2-2.2.5]$ $TOP/tophat2 -G yeast_SGD_anno.gtf …
  • bowtie could not build the index
    written by zizigolu zizigolu
    Sorry guys, I was building transcriptome index: I have `yeast_SGD_anno.gtf` and `orf_coding.fasta` as input which are in bowtie2 folder, then I typed: ``` [izadi@lbox161 bowtie2-2.2.5]$ …
  • Tophat 'prep_reads error": beginning of quality values record not found!
    written by mmitra • mmitra
    Hi all, I ran tophat on my fastq file and I got the following error: [2015-09-02 11:23:58] Beginning TopHat run (v2.1.0) ----------------------------------------------- [2015-09-02 11:23:58] Checking …
  • how I can put bowtie2 with tophat2 in the path?
    written by zizigolu zizigolu
    Hey guys, ``` [izadi@lbox161 ~]$ bash [izadi@lbox161 ~]$ cd /usr/data/nfs6/izadi/gij/test_data [izadi@lbox161 test_data]$ pwd /usr/data/nfs6/izadi/gij/test_data [izadi@lbox161 test_data]$ ls reads_1.fq test_ref.2.bt2 test_ref.fa test_ref.rev.2.ebwt reads_2.fq test_ref.2.ebwt test_ref.rev.1.bt2 test_ref.1.bt2 …
  • tophat Preparing reads [FAILED]
    written by justinfanyi • justinfanyi
    Why is tophat giving this error message? biostat1@biostat1-ubuntu:~/src/tools/test_data$ tophat2 -r 20 test_ref reads_1.fq reads_2.fq [2014-05-24 17:02:09] Beginning TopHat run (v2.0.11) ----------------------------------------------- [2014-05-24 17:02:09] Checking for …