How to remove technical read including known sequnce
Hi, I have a problem during QC and would like you to give me a hint.
I studied how to remove adapter sequence from 5' end and 3' end,
But I don't know the way to get rid of technical reads (not adapter) that contain known sequence.
For example, there following read in raw fastq file.
@id_01 length=62
GACTACGTACA**GAACAGATAATGACCATTTATAC**CGGAACAAATGGTTATCTGGATGGATTA
+id_01 length=62
IIIIIIIIIICCCFFFFFHHHHHJJJJJJJJJ<HHIJJJJJJJJJJFHIJJJJJIJJJJJJJ
The GAACAGATAATGACCATTTATAC sequence is generated from vector plasmid.
So I want to get rid of this read from all read before high-dimensional analysis.
Anyone has solution?
I'm sorry that I'm beginner in bioinformatics and my clumsy English.Thanks.
1 answer
You can use BBDuk for that:
bbduk.sh in=reads.fq out=clean.fq literal=GAACAGATAATGACCATTTATAC k=23
You can add the flag hdist=1 if you want to allow 1 substitution.
• 0 views
•
link
updated
by
Ram
•
written
by
Brian Bushnell
•
written
by
Brian Bushnell
Log in to answer this question.
More posts like this
-
How to figure out adapter sequence to use for trimming old miRNAseq data
written by hsothers •
-
Overrepresented sequence in reverse read
written by Jaskaran Singh •
-
Tool: TGSFilter, An ultra-fast and efficient tool for long reads filtering and trimming
written by Huiyang •
-
invalid deflate data (invalid code lengths set)
written by leonmcswain •
-
smRNA-seq adapter trimming cutadapt
written by woongjaej •
-
Amplicon sequencing: how to handle adapters and primers?
written by lamteva.vera
-
cutadapt and paired-end reads when you don't know your adapter sequences...
written by beegrackle
-
per tile sequence quality decreases after QC with sickle
written by mary •
-
whole genome sequencing data QC problem (different performance of different softwares)
written by zhengyunchaosky •
-
Illumina adapter diagram
written by pjkriebel •
