Hello, please help me find/create small SAM files (e.g. with less than 10 reads) to help me:
For example, to test handling of duplicate reads I manually typed up this example based on the SAM spec (tabs not preserved):
@SQ SN:chr1 LN:50
read1 16 chr1 1 255 50M * 0 0 ATTTAAAAATTAATTTAATGCTTGGCTAAATCTTAATTACATATATAATT <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< NM:i:0
read1 1032 chr1 1 255 50M * 0 0 ATTTAAAAATTAATTTAATGCTTGGCTAAATCTTAATTACATATATAATT <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< NM:i:0
I hope this is correct, but having lots of tiny SAM examples could help me more quickly and confidently understand the SAM spec so I can generate better test cases.
I am about to create test cases with paired end reads with gaps, and before doing so I hope I might find more tiny SAM examples and/or better resources given my background.
I have found this link useful for manually creating SAM files: http://genome.ucsc.edu/goldenPath/help/bam.html
Thanks
•
written
by
jdimatteo •
Probably the best thing to do for making small SAM examples is to simulate a small number of reads.
This is a nice overview, including how to generate reads using wgsim: http://biobits.org/samtools_primer.html
Here are sample steps to generate a single paired read from hg19:
download hg19 reference genome, e.g.
wget http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.fai
wget http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz
gunzip human_g1k_v37.fasta.gz
filter out a single chromosome and index it, e.g.
samtools faidx human_g1k_v37.fasta 20 > human_g1k_v37_chr20.fasta
bowtie2-build human_g1k_v37_chr20.fasta homo_chr20
simulate a single read sample, e.g. here is for a single (-N 1) paired read:
wgsim -N 1 human_g1k_v37_chr20.fasta single.read1.fq single.read2.fq > wgsim.out
generate the sam, e.g.
bowtie2 homo_chr20 -1 single.read1.fq -2 single.read2.fq -S single_pair.sam
generate a bam
samtools view -b -S -o single_pair.bam single_pair.sam
sort and index it
samtools sort single_pair.bam single_pair.sorted
samtools index single_pair.sorted.bam
If you modify the simulated reads and/or create them from scratch, these are useful resources:
•
written
by
jdimatteo •
After reading the comments and other answers, this is what I ended up doing, so I figured I'd share the explicit steps I took in case it helps someone else.
under samtools/examples : https://github.com/samtools/samtools/tree/develop/examples
* toy.sam
* ex1.sam.gz
..
You can use following links to download a real bam file for 1) human: http://www.1000genomes.org/data and 2) mouse: ftp://ftp-mouse.sanger.ac.uk/REL-1410-BAM/. For RNAseq files, you can download whole brain transcriptome data for various mouse strains here: ftp://ftp-mouse.sanger.ac.uk/current_rna_bams
The specifications for SAM format can be downloaded using this link: https://samtools.github.io/hts-specs/SAMv1.pdf
I would suggest you to go through the source code of existing tools that process the sam/bam files. For example, there is a feature in Picard tool (http://broadinstitute.github.io/picard/) to validate the SAM/BAM format. You can go through the code to get an idea of what information it looks for to validate the file.
•
written
by
Ashutosh Pandey
Thanks, picard-tools ValidateSamFile seems helpful
Please note however that I am specifically looking for small SAM files that are easily manually understandable for testing / unit testing, not real/large BAM files. (Real/large BAM files seem abundantly available unlike small SAM test files accompanied by explanations of meaning).
•
written
by
jdimatteo •
Log in to answer this question.
It's unfortunate that the sam spec is always named SAMv1.pdf, when the actual specification changes rapidly.
(edited - I'm not really sure what I was trying to say).
Anyway, yes, using a random read generator and aligning small numbers of reads to a reference is a good way to explore the sam format, considering that the optional tags are poorly documented.
I'm currently experimenting with wgsim while following this helpful tutorial: http://biobits.org/samtools_primer.html
This online utility to decode/encode a SAM flag to/from plain English is helpful: http://broadinstitute.github.io/picard/explain-flags.html
Perhaps a read generator is the most pragmatic way of generating small correct SAM files for testing purposes.