Bustard Quality Score

Hi, i'm using datasets from SRA and i often find the quality score is set as Bustard, 80x1, if i plan to use top hat/bowtie, can i just assume they are in Phred scale? if not, how can i make the conversion.

sra quality conversion

• 2,383 views • link

updated 12.3 years ago by Biostar

• written 14.7 years ago by Raygozak

Do you have SRA data with Bustard (Illumina intermediate) files?

• 0 views • link

written 14.7 years ago by Torst

0 answers

No answers yet.

More posts like this

Eigen_phred_coding values interpretation
written 2.7 years ago by Lukas •

I have problem with understanding how to interpret Eigen_phred score. I understand the main goal of this tool and know that score value would look …
How is the ABQ field in the VCF file calculated?
written 2.8 years ago by brunomoda •

The only information I found about this field was in the header: ``` ABQ = Average quality of variant-supporting bases (qual2) ```` Can someone provide …
messed up SRA quality scores
written 3.8 years ago by Noah •

I'm having an issue with sequences I download from the SRA having apparently incorrect base quality scores. I downloaded the NCBI SRA run SRR4181534 using …
working with .sra-lite files
written 3.9 years ago by Raygozak

Hi, i'm seeing more and more this .sra-lite files which supposedly have a simplified base score. However, I only see reads with all qualities set …
FASTQ Phred33 average base quality score
written 8.5 years ago by oars

I have a FASTQ dataset where I'm trying to find the average base quality score. I found this old link that helped somewhat (https://www.biostars.org/p/47751/). Here …
Bismark: Minimum MAPQ threshold (MMT) and Minimum Phred threshold (MPT)
written 10.4 years ago by Shicheng Guo

Hi All, Just a simple question. Can we set Minimum MAPQ threshold to the mapping reads and Minimum Phred threshold of base in the bismark_methylation_extractor …
Can Bowtie 0.12.7 Handle Sanger / Illumina 1.9 ?
written 10.4 years ago by fire_water

Hello. I have a user that needs to use Bowtie 0.12.7 (Yeah, old version. Don't ask.) but the quality score format of our FASTQ files …
Vcf File Format Qual Column
written 14.2 years ago by User6891

I'm generating a VCF file which consists of genotype data from 5 individuals. For each variant from each individual I have a Phred Quality Score. …
Computing A Short Read'S Score
written 14.2 years ago by Raygozak

Hi, if i have the following read: <pre><code> @HWI-ST261:7:1:16113:8289#0/1 .CTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCCGGGAGGGGCGCATTTATTAG + BWURTY[YYVacaccccccca_ccc\cc_ccccccccac_c_aYVcccc_c_accc_ZccUUUUVYV_c_[ZVV^ </code></pre> Where the 4th row is the score. as far as i understand …
Calculation Of Average Mapping Quality Over A Given Genomic Region
written 14.6 years ago by Bioscientist

For a given genomic region,how can I calculate: 1.average mapping quality(phred-like) for all mapped reads in the bam file over the region. 2.average sequencing quality(also …