This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How Do I Interpret The Output Generated By Variationhunter?

I'm using Variationhunter to analyze CNV; and when I used hg18 reference genome sometime ago, I usually got the output as:

IL5_286:1:311:10:40    chr1    142188880    142188915    R    141736787    141736822    F    deletion    3    23.930555    0.00257801939733326435
IL5_286:1:317:831:353    chr16    28530262    28530297    R    28517264    28517299    F    deletion    0    26.263889    1.00000000000000000000

The second column tells at which chromosome the potential CNV lies.

Now when I switch to humang1kv37.fasta (one version of hg19), I get output like below:

HWI-ST150_0129:3:47:9776:140941    1 dna:chromosome chromosome:GRCh37:1:1:249250621:1    144308983    144309081    F    143689458    143689556    F    V    4    60    2.254486e-12
HWI-ST150_0129:3:4:4776:183027    GL000225.1 dna:supercontig supercontig::GL000225.1:1:211173:1    6803    6901    F    102087    102185    F    V5    64    1.502623e-12

We can see the format difference is: where used to be "chr#" is replaced by three columns as "1 dna:chromosome chromosome:GRCh37:1:1:249250621:1"

So what's this "1 dna:chromosome chromosome:GRCh37:1:1:249250621:1"? Is it a header indicating chromosome # or sth? Also I can grep this "header" from humang1kv37.fasta; but seems human_hg18.fastq doesn't contain such header-like stuff.

Also "L000225.1 dna:supercontig supercontig::GL000225.1:1:211173:1" is quite confusing to me. What does "L000225.1" standard for? Some unusual part of chromosome? (like mitonchondrial chromosome?)

Thanks a lot.

• 3,767 views • link
updated by Bert Overduin Bert Overduin • written by Bioscientist Bioscientist

1 answer

chromosome:GRCh37:1:1:249250621:1

means that the sequence is

  • a chromosome
  • from the GRCh37 assembly
  • chromosome number 1
  • from basepair 1
  • until basepair 249250621
  • forward strand

in other words, the complete chromosome 1

GL000225 is a supercontig representing a dna sequence of which we don't know where it fits into the assembly. See also EMBL-Bank or GenBank.

Note that there also are supercontigs that represent alternate haplotypes e.g. GL000255.

• 0 views • link
written by Bert Overduin Bert Overduin

Log in to answer this question.

More posts like this
  • samtools flagstat returning 0% align reads
    written by Bioinformatist Newbie Bioinformatist Newbie
    Hello, I am using PASH 3.0 for aligning the .fastq file against GRCh37 genome (Using PASH is mandatory here). I am using the following command: …
  • Reading colon delimited description from Fasta file possible?
    written by bfeeny • bfeeny
    I am working with human_g1k_v37.fasta which is found on the 1000genomes site, specifically: ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/ I have parsed this into files of individual chromosomes. The header …
  • 200Bp Long Query Returning 201Bp
    written by secretjess secretjess
    <p>In Ensembl when I use this <a href="http://www.ensembl.org/Homo_sapiens/Export/Output/Location?db=core;flank3_display=0;flank5_display=0;output=fasta;r=X:200000-200200;strand=1;coding=yes;cdna=yes;utr3=yes;peptide=yes;intron=yes;exon=yes;genomic=unmasked;utr5=yes;_format=Text">link</a> to return the sequence on the sense strand of X chromosome between 200000 and 200200 I get …
  • Iupac Bases In The Hg19 1000G Reference ?
    written by Gabriel R. Gabriel R.
    <p>If you download the reference from 1000g :</p> <p><a href="ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz">ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/reference/human_g1k_v37.fasta.gz</a></p> <p>Why is there a double "RR" in chr 3 ?</p> <pre><code>zcat human_g1k_v37.fasta.gz.1 | grep -n …
  • Error - Skipping Invalid Roi
    written by sharan.janjuha • sharan.janjuha
    <p>Hi,</p> <p>I am trying to use the command "genome music bmr calc-covg"</p> <p>genome music bmr calc-covg --bam-list=/home/duttlab/Documents/path<em>bam</em>file --output-dir=/home/duttlab/Documents/music<em>output/ --reference-sequence=/home/duttlab/Documents/GRCh37/human</em>g1k<em>v37.fasta --roi-file /home/duttlab/Documents/cervical/755/BT755</em>ROI<em>filter</em>sorted_1based.roi</p> <p>and I'm getting the …
  • Problems With Mirdeep2
    written by pmuench • pmuench
    <p>I want to find miRNAs on a fastq file with <a href="http://www.mdc-berlin.de/en/research/research_teams/systems_biology_of_gene_regulatory_elements/projects/miRDeep/index.html">mirDeep2</a>. After adapter clipping and alignment (with mapper.pl from mirDeep2) against <code>human_g1k_v37</code> (indexed with …
  • Weird Lines Of Fastq File
    written by Bioscientist Bioscientist
    <p>Usually we see fastq format like:</p> <pre><code>@HWI-ST150_0129:3:1:6030:54572#0/2 GTGAGTACAAGAGATAATTTCAGAGGTATTTGGAATATAGATTTTTAAAAGTAGTTTTGAAGACTTTTTTAAAACAGCATTTAAAAGGTTTTTGGTGCCAA +HWI-ST150_0129:3:1:6030:54572#0/2 b`bbb`ccc`bYbb`ffeefc^dcccYbcccaa`bddddeffccfdddcd```bbcddddeec^ecffc^dddcddZdcc^^ddac`T_bTW\V`\b```d </code></pre> <p>However recently I came across very weird lines like:</p> <pre><code>dd\ecce^eee`eddaaecfedfccdadfeedfe`eac\]a_Z\\`cada\dT]U_bbYd^dadYad`d^`d^^_cTaYbYb^dd\dTUTQVI\\\\SUUaBBBWI-ST150_0129:3:1:5776698:942532 dd\GTCACTGAGTTTCAGCAACAATCTCTGTTTTCTTTGGAATTACCGCCACTAGACCTGAATTACCATCTTCAGGCCTAGCAGTGGTAATTCCTTCCCATATTWI-ST150_0129:3:1:6286698:942532 dd\ffffffffefefff^fcfffefafffffffdfdd`^efcffeefefefffffaffeeeeYdddc`addcdcdcde`YYb^``b^GVVWZY_TY`^POYXO^WI-ST150_0129:3:1:57767238942522 dd\CACGGGTAACCTCTAAACACACATATGCTAGTAAGAGCAAAGTAACACAGACAGCAAAGACTGGAAAAAATAACGAATCCTTCAATGCGAAGACATAGTTGWI-ST150_0129:3:1:62867238942522 </code></pre> …
  • Extract One-End Mapped Paired-End Reads From Bwa Bam/Sam Files.
    written by Bioscientist Bioscientist
    <p>Now need to use Pindel(split-read approach to identify CNV). I'm just wondering how I can extract one-end mapped reads from <a href='http://bio-bwa.sourceforge.net/'>BWA</a> result? Does <a …
  • In 1000Genomes Data, Some Cnvs Are In A Position Higher Than The Chromosome Length
    written by Yh Path • Yh Path
    <p>Hi, I am doing CNV detection based on read depth and wanted to compare my result with the golden set published by the 1000GP group. …
  • 1000 Genomes Human Reference Assembly File With Non Actgn Chars In Chr 3, Why?
    written by Pablo Marin-Garcia Pablo Marin-Garcia
    <p>I am using the 1000 genomes human assembly reference file </p> <p>wget <a href="ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/technical/reference/human_g1k_v37.fasta.gz">ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/technical/reference/human_g1k_v37.fasta.gz</a></p> <p>and It was working OK with bwa but not with other …