This is a test version of Biostars. For the public version, visit https://www.biostars.org.
200Bp Long Query Returning 201Bp

In Ensembl when I use this link to return the sequence on the sense strand of X chromosome between 200000 and 200200 I get the following output:

>X dna:chromosome chromosome:GRCh37:X:200000:200200:1
CCAAACCCCAGGCAGGAGACCAGCCCGTGTTATACGGTGCCTGGAGGAGGCGTGACTCAT
TTGCATAGCGCTGAGGGGATTGGTCTGACCAGGCCTGTCATTCACGTAGCCCGCGAAAAA
CCTGGCCCGCCCACCCCAGTTCCGTAATATGCAAATGTAGGGCGCCATGATGTTCCACAC
GCCTGAGGGTAGTGGGGGCGG

This contains 201 nucleotides, but from my query I was expecting 200. Where has this extra nucleotide come from? Which position is it at? Is my query wrong?

ensembl sequence
• 4,024 views • link
updated by Istvan Albert Istvan Albert • written by secretjess secretjess

This is absolutely fine. Look, if you specify your range as 200000:200001 you will have two nucleotides: (1) C at position 200000 and (2) C at position 200001. So, length = end - start +1.

• 87 views • link
written by Andrzej Zielezinski Andrzej Zielezinski

That's a really good way of explaining it - makes complete sense now, thank you!

• 0 views • link
written by secretjess secretjess

To complete the answer: this is because Ensembl uses closed intervals both for end and beginning coordinates (ie. your end coordinate will be considered as the last one of the interval).

• 0 views • link
written by vodka vodka

1 answer

This has been answered above C: 200bp long query returning 201bp by a.zielezinski just adding it here to mark the question as answered.

The choice of interval representation (zero or one based) has advantages and disadvantages that have long intrigued people. It is a non-trivial matter and has many implications as demonstrated by numerous posts here and elsewhere

and many others

• 119 views • link
written by Istvan Albert Istvan Albert

Log in to answer this question.

More posts like this