200Bp Long Query Returning 201Bp
In Ensembl when I use this link to return the sequence on the sense strand of X chromosome between 200000 and 200200 I get the following output:
>X dna:chromosome chromosome:GRCh37:X:200000:200200:1
CCAAACCCCAGGCAGGAGACCAGCCCGTGTTATACGGTGCCTGGAGGAGGCGTGACTCAT
TTGCATAGCGCTGAGGGGATTGGTCTGACCAGGCCTGTCATTCACGTAGCCCGCGAAAAA
CCTGGCCCGCCCACCCCAGTTCCGTAATATGCAAATGTAGGGCGCCATGATGTTCCACAC
GCCTGAGGGTAGTGGGGGCGG
This contains 201 nucleotides, but from my query I was expecting 200. Where has this extra nucleotide come from? Which position is it at? Is my query wrong?
• 4,030 views
•
link
1 answer
This has been answered above C: 200bp long query returning 201bp by a.zielezinski just adding it here to mark the question as answered.
The choice of interval representation (zero or one based) has advantages and disadvantages that have long intrigued people. It is a non-trivial matter and has many implications as demonstrated by numerous posts here and elsewhere
- What are the advantages/disadvantages of one-based vs. zero-based genome coordinate systems
- Why numbering should start at zero
- Why numbering should start at one
and many others
• 119 views
•
link
Log in to answer this question.
This is absolutely fine. Look, if you specify your range as 200000:200001 you will have two nucleotides: (1) C at position 200000 and (2) C at position 200001. So, length = end - start +1.
That's a really good way of explaining it - makes complete sense now, thank you!
To complete the answer: this is because Ensembl uses closed intervals both for end and beginning coordinates (ie. your end coordinate will be considered as the last one of the interval).