This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Weird Lines Of Fastq File

Usually we see fastq format like:

@HWI-ST150_0129:3:1:6030:54572#0/2
GTGAGTACAAGAGATAATTTCAGAGGTATTTGGAATATAGATTTTTAAAAGTAGTTTTGAAGACTTTTTTAAAACAGCATTTAAAAGGTTTTTGGTGCCAA
+HWI-ST150_0129:3:1:6030:54572#0/2
b`bbb`ccc`bYbb`ffeefc^dcccYbcccaa`bddddeffccfdddcd```bbcddddeec^ecffc^dddcddZdcc^^ddac`T_bTW\V`\b```d

However recently I came across very weird lines like:

dd\ecce^eee`eddaaecfedfccdadfeedfe`eac\]a_Z\\`cada\dT]U_bbYd^dadYad`d^`d^^_cTaYbYb^dd\dTUTQVI\\\\SUUaBBBWI-ST150_0129:3:1:5776698:942532
dd\GTCACTGAGTTTCAGCAACAATCTCTGTTTTCTTTGGAATTACCGCCACTAGACCTGAATTACCATCTTCAGGCCTAGCAGTGGTAATTCCTTCCCATATTWI-ST150_0129:3:1:6286698:942532
dd\ffffffffefefff^fcfffefafffffffdfdd`^efcffeefefefffffaffeeeeYdddc`addcdcdcde`YYb^``b^GVVWZY_TY`^POYXO^WI-ST150_0129:3:1:57767238942522
dd\CACGGGTAACCTCTAAACACACATATGCTAGTAAGAGCAAAGTAACACAGACAGCAAAGACTGGAAAAAATAACGAATCCTTCAATGCGAAGACATAGTTGWI-ST150_0129:3:1:62867238942522

Can anyone give a hint what's this? Some special format for Illumina 1.5+? thx

edit: I actually transfer this file from other server using "scp". Original file is pretty good; while the one after being transferred is crappy! This is so weird! This is really

fasta
• 384 views • link
updated by User 4368 • User 4368 • written by Bioscientist Bioscientist

I'll second the "corrupt" statement. It's nothing which should ever come out as FASTQ. Look upstream for any program which might have scrambled your data.

• 0 views • link
written by Bach • Bach

How did you get the fastq? Did you extract it from a NCBI SRA file?

• 0 views • link
written by Damian Kao Damian Kao

i actually just get from my collaborator. ...

• 0 views • link
written by Bioscientist Bioscientist

Try doing a sha1sum on the file on the server and the file you downloaded to see if it was indeed corrupted.

• 0 views • link
written by Gww Gww

1 answer

Your file is definitely corrupt. The end of each line contains the header of the next line. You can fix it yourself somehow, but I'd say try transferring it somehow so that the encoding will not change the file contents.

• 1 views • link
written by User 4368 • User 4368

Log in to answer this question.

More posts like this