This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Multiple fasta to one fasta in galaxy
I have something like this >Chr6 C >Chr6 A >Chr6 C >Chr6 A >Chr6 T >Chr6 C I need something like this >Chr6 CACATC Need to use galaxy
galaxy fasta convertion sequencing sequence
• 2,989 views • link
updated by Ram Ram • written by rus2dil • rus2dil

Why is your fasta file(s) looking like this?

• 0 views • link
written by BioApps BioApps
It is because after mapping with BWA, generated pile up, the converted to fasta, which resulted single fasta file with multiple sequences.
• 0 views • link
written by rus2dil • rus2dil

2 answers

Assuming your file is same as what you have shown here, following should work

perl -pe 's/\s\S\w{3}\d{1}\s//g' yourFile.fasta > outputFile.fasta
• 0 views • link
updated by Ram Ram • written by venu venu

Hello,

Protocol #5 in this pub shows exactly how to manipulate MAF data in Galaxy. Filter with regex, convert formats, etc. It is open source and the examples are in a live tutorial with a video: http://usegalaxy.org/u/galaxyproject/p/using-galaxy-2012

Thanks, Jen, Galaxy team

• 1 views • link
updated by Ram Ram • written by Jennifer Hillman Jackson Jennifer Hillman Jackson

Log in to answer this question.

More posts like this
  • Seqkit Replace
    written by pablo pablo
    Hi, I would like to replace my FASTA headers according to a matching file. I have : ``` head my.fasta >CM020909.1:14117 aTTTTTGTCCCCAatattaggccctatgttctcacatttcacaatttttt[C/T]ccccaaaattaggccctatgttcccacatttcaagatttattttttccaa >CM020909.1:148127 TTACTTTGTAGTAGCTTTTACTTTGTAGCTAGAGGCTTGGCTGTGCTGTT[T/A]GGGCTTTTACTGTAGTGGCTTGGGTTGGTAGTGACTTTGAAGGAGGTTAA >CM020909.1:254785 …
  • vcf variant selection
    written by ethan.kreuzer • ethan.kreuzer
    I have vcf files that I want to convert into .bed files with plink to use for proxy search. One issue I am having is …
  • How Can I Find SNP id from Chromosome Position?
    written by Raju • Raju
    Hello Folks, I have two DataFiles T-Gene.csv Chr,Start,End,ID 6,38517417,38517437,kgp17152035 6,38517556,38517576,rs4254983 6,38517997,38518017,kgp10250023 6,38519465,38519485,kgp17245206 6,38519751,38519771,kgp8446980 6,38519946,38519966,kgp17382319 6,38520249,38520269,kgp17414348 6,38521434,38521454,kgp2796714 6,38522620,38522640,rs17614684 T-Gene_Links.csv Gene_ID,Gene_Name,TSS_ID,TSS_Locus,Strand,Max_Expr,RE_Locus,Max_Hist,Distance,Closest_Locus,Closest_TSS,Histone,Correlation,Correlation_P_Value,Distance_P_Value,CnD_P_Value,Q_Value ENSG00000112164.5,GLP1R,ENST00000373256.4,chr6:39016574-39016574,+,3.06,chr6:39041458-39041477,0.0,24884.0,F,T,H3k27ac,0.43676529,0.04292,0.04979,0.01528,0.9006 ENSG00000112164.5,GLP1R,ENST00000373256.4,chr6:39016574-39016574,+,3.06,chr6:39053087-39053106,0.0,36513.0,F,F,H3k27ac,0.40457163,0.05091,0.07304,0.02452,0.9006 ENSG00000112164.5,GLP1R,ENST00000373256.4,chr6:39016574-39016574,+,3.06,chr6:39049954-39049973,0.0,33380.0,F,F,H3k27ac,0.40299158,0.05134,0.06678,0.02289,0.9006 ENSG00000112164.5,GLP1R,ENST00000373256.4,chr6:39016574-39016574,+,3.06,chr6:39041701-39041720,0.0,25127.0,F,T,H3k27ac,0.39967616,0.05211,0.05027,0.01819,0.9006 ENSG00000112164.5,GLP1R,ENST00000373256.4,chr6:39016574-39016574,+,3.06,chr6:39047953-39047972,0.0,31379.0,F,F,H3k27ac,0.39680426,0.05283,0.06278,0.02225,0.9006 ENSG00000112164.5,GLP1R,ENST00000373256.4,chr6:39016574-39016574,+,3.06,chr6:39049196-39049215,0.0,32622.0,F,F,H3k27ac,0.39410562,0.05358,0.06526,0.02328,0.9006 …
  • Structural Variants (SV) Manta output interpretation: MantaBND and translocation lenght
    written by nihilior • nihilior
    Hi everyone, Manta novice here. Does anybody know how is possible to retrieve the translocation lenght from Manta SV output (if it makes sense)? For …
  • Get gVCF file from genome coordinates
    written by Paul Paul
    Dear all, I have bed file like: Chr \t start \t stop And I woud like to add to fourth column information about reference allele …
  • From aligened sliced and filtered bam to single sequence in fasts format
    written by rus2dil • rus2dil
    Hello, I have mapped 6 paired illumina raw reads against a reference genome and filtered by mapping quality and chromosome number 6. Then sliced using …
  • What are the steps to follow to extract a promoter region starting from illumina 2000 fastq read
    written by rus2dil • rus2dil
    What are the steps to follow to extract a promoter region starting from illumina 2000 fastq read? I am new to this and I want …
  • How to merge sequences in a BAM file to one sequence?
    written by rus2dil • rus2dil
    <p>I have an aligned BAM file and I need to merge all the sequences inside to one sequence. How should I do it? in Galaxy?</p>
  • Are these steps correct? Galaxy
    written by rus2dil • rus2dil
    I have aligned NGS six runs of a sample using BWA (galaxy platform). Then I merged them into one BAM file. Next I sliced the …
  • Converting A File With Rows And Columns To Just Columns
    written by mphillips6789 • mphillips6789
    <p>I have a file with entries that look like this:</p> <pre><code>Pos/Line p 148 A 0 C 0 G 0.081985 T 0.918015 207 A 0.021697 C …