Hi
I have some RNA samples(paired-end reads) . The cDNA synthesised by TruSeq RNA sample preparation kit and sequenced by illumina Hiseq 2000 platform .
I would like to use trimmomatic to trim the reads. Can anyone let me know how I can find the adaptor sequence?
Thank you
4 answers
- You will get this information from the sequencing facility from where the data is generated.
- Run FASTQC and look at the over represented sequences, which may give the name of the adapter sequence. It looks for different adapters which are listed here.
- Use universal adapter sequences of TruSeq kit:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
•
written
by
GouthamAtla
Personally I would use /Path-To-Trimmomatic-0.33/adapters/TruSeq3-PE-2.fa
It was included in the binary of Trimmomatic.
Illumina documents adaptor sequences in its "Customer Sequence Letter".
•
written
by
Charles Plessy
http://supportres.illumina.com/documents/documentation/chemistry_documentation/experiment-design/illumina-customer-sequence-letter.pdf probably has the answer you are looking for.
Sorry, Charles Plessy already give the file I mentioned above, forget about it.
Log in to answer this question.
-
How to find adapter sequences for trimmomatic
written by wonde2000 •
-
No trimming of reverse reads using Trimmomatic-0.39
written by hgal4248 •
-
which sequence adapter trimming tool should i use for my illumina 101pb reads ?
written by v.berriosfarias •
-
library type selection problem
written by kuhelikadas1995 •
-
Sequencing (+1bp in length?) and adaptor trimming.
written by Biogeek
-
How to trim adapters from fastq having 8mer+8mer bar-code
written by rice.researcher
-
RNA-seq adaptor sequence
written by Arindam Ghosh
-
Trimming Adaptor in Small RNA Analysis
written by ebrahimiet •
-
Illumina adaptor to be trimmed from fastq RNAseq files
written by ebrahimiet •
-
To identify 3'end extended small ncRNA from small RNA seq data
written by sethugunja •
Thank you so much for sharing the information