This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Single-end vs pair-end mapping

Dear all

I have two fastq files like below. All headers has 1:N:... so, my first question is: are the reads of both files from single-end sequencing?

@HWI-ST279:279:D1BF5ACXX:6:1101:11959:3172 1:N:0:ACAGTG
TCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGA
+
BCCFFDDFHHHGHJIJJJJHIIJJJJJJJBHIJIJJJFHHIIJJJJIJJJI

My second question relates to mapping method. I am a new user of tophat. Can tophat-cufflink be used for ~60bp single-end reads mapping?

Thanks a lot for your suggestions.

tophat bowtie

1 answer

If both end with 1:N..., then those headers indicate single-ended sequencing.

Tophat+Cufflinks can be used for mapping and analyzing 60bp single-ended reads. Which does not mean I'd consider them ideal; I think BBMap+Deseq is probably better.

Hi Walnut, Thank you for your help!

You're welcome. And Walnut is a cute name; I could go by that.

OK, Brian. Cheers!

Log in to answer this question.