This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Explanation for strange kmer enrichment at the end of the RNA-seq reads

One of my RNA seq reads have k mer content looking like below:

Strange Kmer Enrichement

The reads have adapter trimmed. But I don't understand why there is a enrichment at the end of the reads. Has anybody seen this?

rna-seq
• 2,273 views • link
updated by Ram Ram • written by lwc628 lwc628

1 answer

The Illumina Indexed TrueSeq adaptor is GATCGGAAGAGCACACGTCTGAACTCCAGTCAC it seems that you have these show up at the end of the reads. The same enrichment will show up multiple times (shifted).

• 0 views • link
updated by Ram Ram • written by Istvan Albert Istvan Albert

Log in to answer this question.

More posts like this