This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Empty SomaticSniper Output Files

Hi all,

I have a pipeline which I have written in python to do SNP calling and annotation. The pipeline links Samtools, SomaticSniper, and SnpSift/SnpEff together to produce annotated VCF files for human cancer studies. The inputs are two sorted indexed BAM files, and a human reference fasta file, in this case GRCh38.

The first step in my pipeline splits the bams by chromosome. Then each tumor/normal chromosomal pair is run through SomaticSniper as described in the documentation. The pipeline has worked on various BAM files in the past, but my current data set is not working properly. When I run my current BAMs through SomaticSniper, the program runs, exits cleanly (no errors) and produces empty output files every time.

Here is the command I am using to call SomaticSniper:

bam-somaticsniper -F vcf -f /path/GRCh38/hg38.fa /path/TumorBams/Tumor_B02077_CHR1.bam /path/NormalBams/Normal_B02077_CHR1.bam /path/SomSniper/B02077_CHR1Snipe.vcf

Here is a head from one of the BAM files (converted to SAM for display)

@HD     VN:1.0  GO:none SO:none
@SQ     SN:CHR5 LN:181538259    UR:>CHR5
@SQ     SN:CHRM LN:16569        UR:>CHRM
@SQ     SN:CHR22        LN:50818468     UR:>CHR22
@SQ     SN:CHR14        LN:107043718    UR:>CHR14
@SQ     SN:CHR1 LN:248956422    UR:>CHR1
@SQ     SN:CHR4 LN:190214555    UR:>CHR4
@SQ     SN:CHR6 LN:170805979    UR:>CHR6
@SQ     SN:CHR10        LN:133797422    UR:>CHR10
@SQ     SN:CHR12        LN:133275309    UR:>CHR12
@SQ     SN:CHRX LN:156040895    UR:>CHRX
@SQ     SN:CHR19        LN:58617616     UR:>CHR19
@SQ     SN:CHR7 LN:159345973    UR:>CHR7
@SQ     SN:CHR18        LN:80373285     UR:>CHR18
@SQ     SN:CHR13        LN:114364328    UR:>CHR13
@SQ     SN:CHR2 LN:242193529    UR:>CHR2
@SQ     SN:CHR15        LN:101991189    UR:>CHR15
@SQ     SN:CHR3 LN:198295559    UR:>CHR3
@SQ     SN:CHR21        LN:46709983     UR:>CHR21
@SQ     SN:CHR11        LN:135086622    UR:>CHR11
@SQ     SN:CHR20        LN:64444167     UR:>CHR20
@SQ     SN:CHR17        LN:83257441     UR:>CHR17
@SQ     SN:CHR16        LN:90338345     UR:>CHR16
@SQ     SN:CHR9 LN:138394717    UR:>CHR9
@SQ     SN:CHR8 LN:145138636    UR:>CHR8
@SQ     SN:CHRY LN:57227415     UR:>CHRY

r       0       CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAGCCCTAACCCAAACCCTAACCCTGA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       0       CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       0       CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAAACCCAAACCCAAACCCTAA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       0       CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       0       CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       16      CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       16      CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTACCCCTAACCCTAACCCTAA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       16      CHR10   10001   25      76M     *       0       0       CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCACCCTAACCCTAACACTCA    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       0       CHR10   10002   25      76M     *       0       0       TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCAAC    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
r       0       CHR10   10002   25      76M     *       0       0       TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@

You may notice that the quality scores are all @. That is because these are "homemade" BAM files (which I think maybe causing the issues). Any thoughts/ideas as to why I am getting empty files would be appreciated.

Thanks,
Matt

somaticsniper snp

I'm curious about the capitlisation of CHR in the bam file. I've not used GRCh38 but for hg19, the chromosomes do not have a CHR prefixes, but chr prefixes, and GRCh37 has no prefix at all, just the chromosome numbers. Does your reference FASTA file have CHR entries for chromosome names?

It does, we had to modify the the GRCh38 reference to add the capital CHR. Figured that was easier than modifying all of the SAM files we had already created.

Your bam file is not sorted. Did you try sorting it and then run?

What makes you think its not sorted?

The header file says so.

@HD     VN:1.0  GO:none SO:none

SO should say sorted instead of none.

Interesting, I sorted the BAM and then used reheader, which would explain why the header says "none". Samtools and the other tools I have used still accept this file as sorted (they don't tell me it needs to be sorted), so they must check some other aspect of the BAM to determine if it is sorted or not.

Good catch though Jordan. That might have been causing the issues my group was experiencing. We ended up rebuilding all of the files from scratch to get it them to work.

0 answers

No answers yet.

Log in to answer this question.