Thanks, Dr. Bradnam! I've updated my question with just the geneid-train command output as well.
Hi all,
I am trying to get the cegma working on the sample dataset that came along with the package. I have already installed all the pre-requistes (ncbi-blast 2.2.25+, hmmer 3.0, geneid 1.4.4 and genewise 2.4). When executed (as suggested in the README file), I get the error saying that geneid-train did not work properly. Please see the entire STDOUT (verbose) below. Any suggestions will be greatly appreciated!
$ cegma -v -ext --genome sample.dna --protein sample.prot -o sample &>sample_data.stdout
$ cat sample_data.stdout
********************************************************************************
** MAPPING PROTEINS TO GENOME (TBLASTN) **
********************************************************************************
RUNNING: genome_map -n genome -p 6 -o 5000 -c 2000 -t 1 -v sample.prot sample.dna 2>sample.cegma.errors
Building a new DB, current time: 05/01/2014 09:10:46
New DB name: /tmp/genome25484.blastdb
New DB title: sample.dna
Sequence type: Nucleotide
Keep Linkouts: T
Keep MBits: T
Maximum file size: 1073741824B
Adding sequences from FASTA; added 1 sequences in 0.07232 seconds.
Processing KOG: KOG0292
Processing KOG: KOG0328
Processing KOG: KOG0466
Processing KOG: KOG0631
Processing KOG: KOG0659
Processing KOG: KOG1458
Processing KOG: KOG1742
Processing KOG: KOG1762
Processing KOG: KOG1769
Processing KOG: KOG1780
Processing KOG: KOG1992
Processing KOG: KOG2067
Processing KOG: KOG2803
Processing KOG: KOG2916
Processing KOG: KOG3180
Processing KOG: KOG3232
Processing KOG: KOG3418
Processing KOG: KOG3497
Found 86 candidate regions in sample.dna
********************************************************************************
** MAKING INITIAL GENE PREDICTIONS FOR CORE GENES (GENEWISE + GENEID) **
********************************************************************************
RUNNING: local_map -n local -f -h /data004/software/GIF/packages/cegma/2.4.010312/data/hmm_profiles -i KOG -v genome.chunks.fa 2>sample.cegma.errors
Processing chunk: KOG0292.1
Processing chunk: KOG0292.6
Processing chunk: KOG0292.7
Processing chunk: KOG0292.2
Processing chunk: KOG0292.4
Processing chunk: KOG0328.7
Processing chunk: KOG0328.18
Processing chunk: KOG0328.16
Processing chunk: KOG0328.15
Processing chunk: KOG0328.8
Processing chunk: KOG0466.5
Processing chunk: KOG0466.4
Processing chunk: KOG0466.3
Processing chunk: KOG0466.2
Processing chunk: KOG0631.10
Processing chunk: KOG0631.6
Processing chunk: KOG0631.9
Processing chunk: KOG0631.5
Processing chunk: KOG0631.12
Processing chunk: KOG0659.19
Processing chunk: KOG0659.7
Processing chunk: KOG0659.20
Processing chunk: KOG0659.21
Processing chunk: KOG0659.10
Processing chunk: KOG1458.6
Processing chunk: KOG1458.8
Processing chunk: KOG1458.5
Processing chunk: KOG1458.3
Processing chunk: KOG1458.9
Processing chunk: KOG1742.8
Processing chunk: KOG1742.3
Processing chunk: KOG1742.9
Processing chunk: KOG1742.6
Processing chunk: KOG1742.5
Processing chunk: KOG1762.3
Processing chunk: KOG1762.2
Processing chunk: KOG1769.22
Processing chunk: KOG1769.15
Processing chunk: KOG1769.8
Processing chunk: KOG1769.5
Processing chunk: KOG1769.27
Processing chunk: KOG1780.5
Processing chunk: KOG1780.2
Processing chunk: KOG1780.7
Processing chunk: KOG1780.3
Processing chunk: KOG1780.6
Processing chunk: KOG1992.1
Processing chunk: KOG1992.8
Processing chunk: KOG1992.2
Processing chunk: KOG1992.3
Processing chunk: KOG1992.6
Processing chunk: KOG2067.6
Processing chunk: KOG2067.7
Processing chunk: KOG2067.3
Processing chunk: KOG2067.9
Processing chunk: KOG2067.8
Processing chunk: KOG2803.7
Processing chunk: KOG2803.5
Processing chunk: KOG2803.8
Processing chunk: KOG2803.4
Processing chunk: KOG2803.6
Processing chunk: KOG2916.9
Processing chunk: KOG2916.4
Processing chunk: KOG2916.11
Processing chunk: KOG2916.10
Processing chunk: KOG2916.2
Processing chunk: KOG3180.12
Processing chunk: KOG3180.10
Processing chunk: KOG3180.3
Processing chunk: KOG3180.7
Processing chunk: KOG3180.9
Processing chunk: KOG3232.6
Processing chunk: KOG3232.2
Processing chunk: KOG3232.4
Processing chunk: KOG3232.3
Processing chunk: KOG3232.5
Processing chunk: KOG3418.12
Processing chunk: KOG3418.10
Processing chunk: KOG3418.3
Processing chunk: KOG3418.9
Processing chunk: KOG3418.8
Processing chunk: KOG3497.9
Processing chunk: KOG3497.1
Processing chunk: KOG3497.10
Processing chunk: KOG3497.2
Processing chunk: KOG3497.11
NOTE: created 23 geneid predictions
********************************************************************************
** FILTERING INITIAL PROTEINS PRODUCED BY GENEID (HMMER) **
********************************************************************************
RUNNING: hmm_select -i KOG -o local -t 1 -v /data004/software/GIF/packages/cegma/2.4.010312/data/hmm_profiles local.geneid.fa /data004/software/GIF/packages/cegma/2.4.010312/data/profiles_cutoff.tbl 2>sample.cegma.errors
Processing geneid prediction: KOG0292.6
Processing geneid prediction: KOG0292.7
Processing geneid prediction: KOG0328.7
Processing geneid prediction: KOG0328.18
Processing geneid prediction: KOG0328.8
Processing geneid prediction: KOG0466.5
Processing geneid prediction: KOG0631.10
Processing geneid prediction: KOG0659.19
Processing geneid prediction: KOG0659.7
Processing geneid prediction: KOG0659.20
Processing geneid prediction: KOG1742.8
Processing geneid prediction: KOG1762.3
Processing geneid prediction: KOG1769.22
Processing geneid prediction: KOG1992.1
Processing geneid prediction: KOG2067.6
Processing geneid prediction: KOG2067.7
Processing geneid prediction: KOG2803.7
Processing geneid prediction: KOG2803.8
Processing geneid prediction: KOG2916.9
Processing geneid prediction: KOG3180.12
Processing geneid prediction: KOG3232.6
Processing geneid prediction: KOG3418.12
Processing geneid prediction: KOG3497.9
NOTE: Found 15 geneid predictions with scores above threshold value
********************************************************************************
** CALCULATING GENEID PARAMETERS FROM SELECTED GENEID PREDICTIONS **
********************************************************************************
RUNNING: geneid-train -v local.geneid.selected.gff local.geneid.selected.dna geneid_params 2>sample.cegma.errors
DATA COLLECTED: 15 Coding sequences containing 48 introns
Intron model
geneid-train did not work properly
EDIT:
So, when I just run the final step:
$ geneid-train -v local.geneid.selected.gff local.geneid.selected.dna geneid_params
I get:
DATA COLLECTED: 15 Coding sequences containing 48 introns
Intron model
Use of uninitialized value in numeric eq (==) at /data004/software/GIF/packages/cegma/2.4.010312/lib/geneid.pm line 264.
some values in Markov model with zero counts, use pseudocounts at /data004/software/GIF/packages/cegma/2.4.010312/lib/geneid.pm line 270.
8 answers
Hi again,
I think I (finally) might have a fix. The problem might result from people with newer versions of Perl in which an old Perl function is deprecated (in certain situations).
To test whether this is the case, you'll need to change one line in each of the geneid.pm and HMMstar.pm files (inside the lib folder of the CEGMA installation). Maybe make copies of the originals as well. In geneid.pm change line 108 and in HMMstar.pm change line 41 as follows:
BEFORE: $code .= "$tab foreach my \$c$i qw(A C G T) {\n";
AFTER: $code .= "$tab foreach my \$c$i (qw(A C G T)) {\n";
And let me know if that works!
Here is some more info about how this function changed in Perl 5.14: http://blogs.perl.org/users/rurban/2010/09/qw-in-list-context-deprecated.html
As you have run CEGMA with the --ext option to keep intermediate files, could you try running the final step separately to show what the error message from geneid-train is? i.e. run:
geneid-train -v local.geneid.selected.gff local.geneid.selected.dna geneid_params
And then report the output.
Hmm, everything is looking good initially. The output you should be seeing for the gene-id step of CEGMA is something like:
RUNNING: geneid-train local.geneid.selected.gff local.geneid.selected.dna geneid_params 2>test.cegma.errors
DATA COLLECTED: 15 Coding sequences containing 48 introns
RUNNING: make_paramfile /Korflab/Packages/CEGMA/current/data/self.param.template \
geneid_params/coding.initial.5.logs geneid_params/coding.transition.5.logs \
geneid_params/start.logs geneid_params/acc.logs geneid_params/don.logs \
geneid_params/intron.max > geneid_params/self.param
And when I run the separate geneid-train step, I see the following:
geneid-train -v local.geneid.selected.gff local.geneid.selected.dna geneid_params
DATA COLLECTED: 15 Coding sequences containing 48 introns
Intron model
Coding model
don
false_don
acc
false_acc
start
false_start
This is with geneid v1.4...I wonder if they changed something in v1.4.4 that breaks CEGMA?
Actually, ignore my last point. I was running v1.4.4 as well (geneid only reports the version as being 1.4). What platform are you running on?
I am on Linux hpc5 2.6.32-358.11.1.el6.x86_64 GNU/Linux, Red Hat Enterprise Linux Server release 6.4 (Santiago).
Thanks very much for the reply. Yes, I too wondered about the differences between 1.4 (mentioned in CEGMA manual) and 1.4.4 available at geneid website. It seems like there isn't 1.4 version of geneid anywhere. Also, geneid-train is not from the geneid program, it is a part of GEGMA, right?
I don't have much left to suggest, but let's check that the required input files for geneid-train look okay. Can you run the following please:
ls -l local.geneid.selected.gff local.geneid.selected.dna geneid_params
head local.geneid.selected.gff local.geneid.selected.dna
And then print the output here.
Thank you very much for you help! Here are the outputs for the commands:
$ ls -l
output:
total 4188
drwxrwxr-x 2 arnstrm GIF 23 May 1 09:18 geneid_params
-rw-rw-r-- 1 arnstrm GIF 58468 May 1 09:13 genome.blast
-rw-rw-r-- 1 arnstrm GIF 49140 May 1 09:13 genome.blast.gff
-rw-rw-r-- 1 arnstrm GIF 437782 May 1 09:13 genome.chunks.fa
-rw-rw-r-- 1 arnstrm GIF 5232 May 1 09:13 genome.chunks.gff
-rw-rw-r-- 1 arnstrm GIF 511 May 1 09:18 local.extended.tbl
-rw-rw-r-- 1 arnstrm GIF 26461 May 1 09:17 local.geneid
-rw-rw-r-- 1 arnstrm GIF 7424 May 1 09:17 local.geneid.fa
-rw-rw-r-- 1 arnstrm GIF 16794 May 1 09:17 local.geneid.gff
-rw-rw-r-- 1 arnstrm GIF 99177 May 1 09:18 local.geneid.selected.dna
-rw-rw-r-- 1 arnstrm GIF 5283 May 1 09:18 local.geneid.selected.fa
-rw-rw-r-- 1 arnstrm GIF 8385 May 1 09:18 local.geneid.selected.gff
-rw-rw-r-- 1 arnstrm GIF 155 May 1 09:18 local.geneid.selected.id
-rw-rw-r-- 1 arnstrm GIF 820630 May 1 09:17 local.genewise
-rw-rw-r-- 1 arnstrm GIF 4575 May 1 09:17 local.genewise.gff
-rw-rw-r-- 1 arnstrm GIF 104931 May 1 09:18 local.hmm_select.aln
drwxrwxr-x 2 arnstrm GIF 6 Apr 30 10:26 sample
-rw-rw-r-- 1 arnstrm GIF 259 May 1 09:18 sample.cegma.errors
-rw-r--r-- 1 arnstrm GIF 2549974 Jan 4 2012 sample.dna
-rw-r--r-- 1 arnstrm GIF 42025 Jan 4 2012 sample.prot
First few lines:
head local.geneid.selected.gff
output:
# Sequence KOG0328.7 - Length = 7702 bps
KOG0328.7 geneid_v1.4 First 466 566 25.57 + 0 KOG0328.7_1
KOG0328.7 geneid_v1.4 Exon 466 566 25.57 + . KOG0328.7_1
KOG0328.7 geneid_v1.4 Internal 2003 2909 670.58 + 1 KOG0328.7_1
KOG0328.7 geneid_v1.4 Exon 2003 2909 670.58 + . KOG0328.7_1
KOG0328.7 geneid_v1.4 Terminal 5515 5706 145.45 + 0 KOG0328.7_1
KOG0328.7 geneid_v1.4 Exon 5515 5706 145.45 + . KOG0328.7_1
# Sequence KOG0466.5 - Length = 6383 bps
KOG0466.5 geneid_v1.4 First 1938 1947 -3.20 + 0 KOG0466.5_1
KOG0466.5 geneid_v1.4 Exon 1938 1947 -3.20 + . KOG0466.5_1
For the sequence file
head local.geneid.selected.dna
>KOG0328.7
ATGTTTTTCGAATTTCGAATTTTAGTTTCGAATCGAATCCTACGAATTATGAGCGAAAAT
AGCCGATAAATCACCATTTTTCTTGATTTTTTCGATGTAAATTCGTTTATTTTGTAAATT
TCCACCTGAAAATGCTGAATTTCTCTGCAAAAATGCTCGAAAAACAGGGTATTTTCGAAA
ACATTCGAAATCTTGCTCTTTTACTAGTTTTTTATCGATTTTACAGGTTTTTCTTAATTT
TTTCGATGTAAATTCACTTATTTTGTTAATTTCCTCCTAAAAATCTTGAATTTCTCTGCA
AAATGCCCGAAAATAATCAATTTTATCGTTTTTACACGTTTTTCTTGATTTTTTCGATGT
AAATTCATTGATTTTGATAATTTCCACCTAAAAATGCTGAATTTCTCTGCAAAAATGCTC
GAAAATATTCATTTTTATCGATTTTACAGAGTTCTTCCTTCAAAAATGGCGGAAAATAAA
AAGAAAAACGACGATATGGCGACTGTGGAGTTCGAGTCGTCTGAGGAGGTCTCAATTATC
Also, for the parameters directory:
$ ls -l geneid_params/
total 4
-rw-rw-r-- 1 arnstrm GIF 78 May 1 10:12 intron.max
I'm stumped, so I can only suggest the following steps to at least try to narrow down where exactly the error is occurring.
Make a copy of the geneid-train script. E.g.
cp geneid-train geneid-train2Add
__END__after line 92. E.g.my $intron_initial = new geneid::SequenceModel('intron', 'FREQ', 4, \@intron, 10, 0); __END__Then test the script as before (but using your modified code):
geneid-train2 -v local.geneid.selected.gff local.geneid.selected.dna geneid_paramsDo you still see the same error message? If not, move the
__END__token to after line 97. E.g.my $intron_transition = new geneid::SequenceModel('intron', 'MM', 5, \@intron, 10, 0); __END__- I'm betting that one of these two lines is producing the error message (which means digging into a very poorly documented Perl module to troubleshoot further...I didn't write this code by the way!).
I really can't imagine why everything else would work but then fail at this step. Just to double check, you didn't interrupt the code part way the first time you ran it, and then restarted?
Thanks for the reply, I think my issue has been resolved. I grabbed a working copy of geneid-train, compiled on a different machine and did a diff between them
$ diff geneid-train geneid-train_2
1c1
< #!/bin/perl
---
> #!/data004/software/GIF/packages/perl/5.18.2/bin/perl
It seems like, when I run make (CEGMA package) it would add this non-conventional shebang line to all perl scripts. Somehow, geneid-train was the only one that got affected by this. Once I changed it back to #!/bin/perl, it is running fine!
Thanks once again for your valuable time! I greatly appreciate your help!
Hmm, I'm pretty stumped by this. Not sure why everything would work until that one specific part of the geneid-train script. The only thing I can think of is to really nail down as to which part of the script is causing the problem. My suggestion:
- Create a copy of the geneid-train script (e.g.
cp /path/to/geneid-train geneid-train2) Add an
__END__token around line 94. E.g.my $intron_initial = new geneid::SequenceModel('intron', 'FREQ', 4, \@intron, 10, 0); __END__Run this new script:
./geneid-train2 -v local.geneid.selected.gff local.geneid.selected.dna geneid_paramsIf this doesn't produce an error, move the
__END__token down a few lines. E.g.my $intron_transition = new geneid::SequenceModel('intron', 'MM', 5, \@intron, 10, 0); __END__- Save and run script again. I'm betting that one of these two lines will report the error. Then we have to try to fathom out what is happening in the not-very-easy-to-understand geneid Perl module.
Adding __END__ at 94th line didn't make any difference, but at line 91 made it go away.
# compositional markov models
print "Intron model\n" if ($opt_v);
__END__
my $intron_initial = new geneid::SequenceModel('intron', 'FREQ', 4,
\@intron, 10, 0);
# this might be the offending line!
Thanks,
Hmm, not for the first time an answer I posted to this thread failed to post (or was removed?). 2nd attempt...
I think I have an answer. To test it, you'll need to change one line of code in two different Perl module (it's the same line of code). Make backups of geneid.pm and HMMstar.pm (in CEGMA/lib directory). Then change one line in the dna_word_table subroutine (this is line 41 in HMMstar.pm) as follows:
OLD: $code .= "$tab foreach my \$c$i qw(A C G T) {\n";
NEW: $code .= "$tab foreach my \$c$i (qw(A C G T)) {\n";
The addition of the 2nd set of parentheses might make all the difference and remove your problem. Please let me know if this works.
Hi Dr. Bradnam, Sorry for the delay, yes this fixed the problem. I was able to complete the analyses with the sample data! Thanks once again!
Edit:
BTW, your comment wasn't deleted. The organization of biostars is quite different from traditional forum. Each reply is considered as a separate answer and each answer is moved up/down depending on up votes it gets. Someone upvoted your latest reply and it is now ranked as the second best answer!
(this entire thread would normally be a single answer with subsequent replys added as comments to it)
Ah so that's where it went! Thanks for letting me know. I guess this merits a small release to the CEGMA code (and I was hoping to not have to touch CEGMA v2 again!).
Hi,
I'm using ncbi_blast+/2.2.28, hmmer/3.0, geneid 1.4.4, genewise 2.4.1, and perl 5.10.1. Everything works fine with the sample file, but I am getting the same error as above with my datafile which is a transcriptome of 46,474 ORFs. I applied the fix above, to geneid.pm and HMMstar.pm even though I am not using perl 5.14 (though I've tried the sample file using both perl 5.14 and 5.10 and it works with both even with the fix to geneid.pm and HMMstar.pm).
Here is a sample of my input file:
>m.10939
TGTCAGGgggTGGgggAGAGGTTTCCTGGCCGCTTCTGTGGGCCACCGTCGGTGTCGTCCTGCAGCTGCCCTCCTTTGCAGCCAGAGCCACTGGCACTGTCCCCGAGAAGGCCCTCCCCTCCCGTGGGCTCCCTCCTCTGCCTGCAGCTCTTTCGTTGtgtgAGGgggAGCCCGCCcccTGTGGAAGGCATGCACCTGACCCACATATTTCCTCTGAGCCCTGCCTTGCTCCTACAGTCCCCACCTGGggggggAGCAGAGGACCTTCCTCCCTctctTATTCTTtttCCTTCCTTCCTT
>m.27653
ATGTTTGCAGGAGATGAGCTGGCAGTAGTACAGAGCTGGGAAGCCCCTTCAGTGGCAGATTCAATGGAGACAGGCAAGGTTTGCACTATGGCCATGATGGTCACAGTAGAGACTTTGCAAGTGATCTCTGTTTATCCACTACAGGCAGGTGAGAAGAGTCCACTGGCCTTCAATGATGTGAAAAGGGGAGCCTCCCTCGCGAATATGAGCCTCAGGACAGCCGATTCCAGTGTCCGGCTCCCGTCGCCCACCCCATTCGACTGCCGCCCCAACTTCTCTTCATGCTCTGTCTCAGATTCA
>m.48642
ATGTTCAACAAATCACAATACTTCTCTGCTGTTATTGCATCCACAGAATGTCACCCAGTGGCCCTGTTTAGGGTTACCTGGACAGTTCTCAAGAAAATGAGCCCAGAGGCCCATCTGCAGGGCCATGTGGAGGAATTTTCCATGCATCTGGAGGAAaaaaTCACTCTGATTCATTCCCAGTTGGACGTGAAGCATACTGTCGAGCTGTCCAGGGAGCATATTTACCCAGTTGGATCTGAGGAAGTGGACAGGGTCCTCCAGAATTTAAACATTAGATCCATACTACTCCTGTCTGGTTAA
>m.2225
AACATCTGGTACGGCTTCACAACCACCCTGCTGTCCTCCGGCGTTGACGTGGTGCTGATCGCCGCCTCTTACGCTCTGATCCTCCGGGCCGTCTTCCAGCTCTCCTGCAAGGAAGCCCGGCGGAAAGCTCTCCGCACCTGCGGCTCCCACATCTCCGTCATCCTCATGTTCTACATGCCAGCCTTCTTCTCCTTCCTCACCCATCGCTTCGGCCACAACATCCCTAGCTGGATCCATATCCTGCTGGCCGACCTCTACGTGATCGTGCCGCCCATGCTCAACCCCATTGTCTACGGAGTC
>m.21342
ATGGCAGATTCCGGAGGgggAGATAGAGTTACATCAGGGGAGACTGATACACCCCGATCCACACTGGCTACAACTAGCCATGTGGAGATTGAGCGGGAGCCCCTGAgagagGCTCACCTGTCGCTGCGGGTGGTTTGGACCATAGAGGCCTTGCACAGGAAATGCACTACGAGGATCTATGATTCCTCCTGGACTTCCTTAGTGGCCCGGTTTCAAGCAGCCCAGGTAATGCCCACCAGGCCACAGTTCCACAGGTCCTTGACTTTGTCCAGGACGAGTTGGATAAGGGGCTCTCCTTAG
Here is the command issued:
cegma -v -ext -g /panfs/roc/groups/14/mcgaughs/mcgaughs/ref.fa
********************************************************************************
** MAPPING PROTEINS TO GENOME (TBLASTN) **
********************************************************************************
RUNNING: genome_map -n genome -p 6 -o 5000 -c 2000 -t 1 -v /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/kogs.fa /panfs/roc/groups/14/mcgaughs/mcgaughs/ref.fa 2>output.cegma.errors
Found 2287 candidate regions in /panfs/roc/groups/14/mcgaughs/mcgaughs/ref.fa
********************************************************************************
** MAKING INITIAL GENE PREDICTIONS FOR CORE GENES (GENEWISE + GENEID) **
********************************************************************************
RUNNING: local_map -n local -f -h /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/hmm_profiles -i KOG -v genome.chunks.fa 2>output.cegma.errors
NOTE: created 1551 geneid predictions
********************************************************************************
** FILTERING INITIAL PROTEINS PRODUCED BY GENEID (HMMER) **
********************************************************************************
RUNNING: hmm_select -i KOG -o local -t 1 -v /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/hmm_profiles local.geneid.fa /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/profiles_cutoff.tbl 2>output.cegma.errors
NOTE: Found 417 geneid predictions with scores above threshold value
********************************************************************************
** CALCULATING GENEID PARAMETERS FROM SELECTED GENEID PREDICTIONS **
********************************************************************************
RUNNING: geneid-train -v local.geneid.selected.gff local.geneid.selected.dna geneid_params 2>output.cegma.errors
RUNNING: make_paramfile /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/self.param.template \
geneid_params/coding.initial.5.logs geneid_params/coding.transition.5.logs \
geneid_params/start.logs geneid_params/acc.logs geneid_params/don.logs \
geneid_params/intron.max > geneid_params/self.param
********************************************************************************
** ACCURATE LOCAL MAPPING **
********************************************************************************
RUNNING: local_map -n local_self -g local.genewise.gff -d geneid_params/self.param -h /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/hmm_profiles -i KOG -v genome.chunks.fa 2>output.cegma.errors
NOTE: created 0 geneid predictions
********************************************************************************
** FINAL FILTERING **
********************************************************************************
RUNNING: hmm_select -i KOG -o local_self -t 1 -v /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/hmm_profiles local_self.geneid.fa /home/mcgaughs/mcgaughs/lcl/opt/cegma/current/data/profiles_cutoff.tbl 2>output.cegma.errors
NOTE: Foud 0 geneid predictions with scores above threshold value
sh: local_self.geneid.selected.gff: No such file or directory
Can't run sed
mcgaughs@labq03 [/panfs/roc/groups/14/mcgaughs/mcgaughs/reftwo] % geneid-train -v local.geneid.selected.gff local.geneid.selected.dna geneid_params 2>output.cegma.errors
DATA COLLECTED: 417 Coding sequences containing 679 introns
Intron model
Coding model
don
false_don
acc
false_acc
start
false_start
mcgaughs@labq03 [/panfs/roc/groups/14/mcgaughs/mcgaughs/reftwo] % ls -l local.geneid.selected.gff local.geneid.selected.dna geneid_params
-rw-rw-r--. 1 mcgaughs mcgaughs 563370 Apr 4 12:12 local.geneid.selected.dna
-rw-rw-r--. 1 mcgaughs mcgaughs 147601 Apr 4 12:12 local.geneid.selected.gff
geneid_params:
total 1104
-rw-rw-r--. 1 mcgaughs mcgaughs 981 Apr 4 13:06 acc.logs
-rw-rw-r--. 1 mcgaughs mcgaughs 57501 Apr 4 13:06 coding.initial.5.logs
-rw-rw-r--. 1 mcgaughs mcgaughs 249017 Apr 4 13:06 coding.transition.5.logs
-rw-rw-r--. 1 mcgaughs mcgaughs 567 Apr 4 13:06 don.logs
-rw-rw-r--. 1 mcgaughs mcgaughs 76 Apr 4 13:06 intron.max
-rw-rw-r--. 1 mcgaughs mcgaughs 310082 Apr 4 12:12 self.param
-rw-rw-r--. 1 mcgaughs mcgaughs 290 Apr 4 13:06 start.logs
mcgaughs@labq03 [/panfs/roc/groups/14/mcgaughs/mcgaughs/reftwo] % head local.geneid.selected.gff local.geneid.selected.dna
==> local.geneid.selected.gff <==
# Sequence KOG0003.2 - Length = 471 bps
KOG0003.2 geneid_v1.4 First 1 376 159.74 + 0 KOG0003.2_1
KOG0003.2 geneid_v1.4 Exon 1 376 159.74 + . KOG0003.2_1
KOG0003.2 geneid_v1.4 Terminal 414 439 -10.69 + 2 KOG0003.2_1
KOG0003.2 geneid_v1.4 Exon 414 439 -10.69 + . KOG0003.2_1
# Sequence KOG0018.2 - Length = 3702 bps
KOG0018.2 geneid_v1.4 First 1 1113 751.23 + 0 KOG0018.2_1
KOG0018.2 geneid_v1.4 Exon 1 1113 751.23 + . KOG0018.2_1
KOG0018.2 geneid_v1.4 Internal 1138 2355 822.39 + 0 KOG0018.2_1
KOG0018.2 geneid_v1.4 Exon 1138 2355 822.39 + . KOG0018.2_1
==> local.geneid.selected.dna <==
>KOG0003.2
ATGCAGATCTTCGTGAAGACCCTGACGGGGAAAACCATCACCCTCGAGGTTGAACCATCT
GATACTATAGAAAATGTCAAAGCCAAGATCCAGGATAAAGAAGGAATTCCTCCTGACCAA
CAGCGTTTAATTTTTGCTGGCAAACAATTGGAGGATGGACGTACTCTGTCTGATTATAAC
ATCCAAAAGGAGTCAACACTTCATCTTGTGCTGAGACTTCGTGGTGGGGCAAAGAAAAGA
AAGAAGAAGTCTTACACCACTCCTAAGAAGAACAAACATAAGAGAAAGAAGGTGAAACTT
GCTGTCCTTAAATACTACAAGGTGGATGAGAATGGCAAAATCAGCCGTTTACGCCGTGAG
TGTCCCTCTGAAGAATGTGGGGCTGGAGTGTTCATGGCTAGCCACTTTGATAGACATTAT
TGTGGCAAGTGCTGCTTGACATACTGCTTCAACAAACCAGAAGACAAGTGA
>KOG0018.2
Any advice would be appreciated! Thanks!!
Suzanne
Hi Suzanne, It would be better if you could post this as a separate question (in a new thread). Since this is already a solved thread, it wont be visible to everyone.
To answer your question: what version CEGMA are you using? getting the most recent version might solve this issue.
Thanks! 2.4 from LPM - I just switched to 2.5 and it fixed the problem. Thanks very much! This was a big help!
Suzanne
Log in to answer this question.