This is a test version of Biostars. For the public version, visit https://www.biostars.org.
In Cigar String, What Is The Difference Between 'N' And 'D' ?

In SAM file, the CIGAR string has the following options:

op    Description
M    Alignment match (can be a sequence match or mismatch
I    Insertion to the reference
D    Deletion from the reference
N    Skipped region from the reference
S    Soft clip on the read (clipped sequence present in <seq>)
H    Hard clip on the read (clipped sequence NOT present in <seq>)
P    Padding (silent deletion from the padded reference sequence)
`

I can not tell the difference between 'D' and 'N' when I analyze split read mapping. could someone give me an example to illustrate the difference?

cigar bam sam
• 19,911 views • link
updated by Ram Ram • written by Chen Sun Chen Sun

Can you show a CIGAR string of such type you encountered??

• 0 views • link
written by Varun Gupta Varun Gupta

2 answers 

REF:  ATCGATCGATCGATCGATCGATCGATCGATCG
          ||||||||||||||||||||||||||
QUERY:    ATC-ATCG-------------ATCAT

The query aligned to the reference would have the cigar: 3M1D4M13N5M if the N operation was being used. This is to distinguish between deletions in exons and large skips due to introns. This only makes sense when you're aligning things like cDNA/expression data. Genomic reads would just have the alignment 3M1D4M13D3M. Does that make things clearer?

• 1 views • link
updated by Ram Ram • written by amblina • amblina

Usage of 'N' is explained in SAM format documentation as follows:

For mRNA-to-genome alignment, an N operation represents an intron. For other types of alignments, the interpretation of N is not defined.

• 59 views • link
updated by Ram Ram • written by lomereiter lomereiter

Log in to answer this question.

More posts like this