This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What file types can I use for the comparison of proteomes?

Hello,

I would like to run the PATRIC's proteome service, but it requires files of this type:

>lcl|NZ_CP097881.1_gene_1 [gene=dnaA] [locus_tag=NAG69_RS00005] [location=1..1404] [gbkey=Gene]
GTGTCACTTTCGCTTTGGCAGCAGTGTCTTGCCCGATTGCAGGATGAGTTACCAGCCACAGAATTCAGTA
TGTGGATACGCCCATTGCAGGCGGAACTGAGCGATAACACGCTGGCCCTGTACGCGCCAAACCGTTTTGT
CCTCGATTGGGTACGGGACAAGTACCTTAATAATATCAATGGACTGCTAACCAGTTTCTGCGGAGCGGAT
GCCCCACAGCTGCGTTTTGAAGTCGGCACCAAACC...

What kind of file is this and how can I generate it?

On the GenBank, the file available are in GB, FASTA, or GFF3 format only...

Thank you

patric proteome
• 614 views • link
updated by Ram Ram • written by marongiu.luigi marongiu.luigi

1 answer

The Proteome Comparison Service performs protein sequence-based genome comparison using bidirectional BLASTP.

Since it uses BLASTP, you need the *_protein.faa file.

The one you posted is the *_cds_from_genomic.fna

• 0 views • link
written by andres.firrincieli andres.firrincieli

Thank you; I found it, it is under the Coding Sequences tab rather than the Complete Record tab.

• 0 views • link
written by marongiu.luigi marongiu.luigi

Accept the answer then, please

• 0 views • link
written by Ram Ram

Log in to answer this question.

More posts like this