Hello,

I am looking for assistance using regex for umi extraction with umi tools.

My reads contain a 23 bp universal sequence followed by a 12 bp umi.

I know these are at the 5' end of my read, because when I extract the first 35 bp with umi_tools to visually inspect, the sequences are exactly as expected.

However, when I attempt to use regex to pull out the umi (which I would prefer to do for multiple reasons), no matches are found.

The code I am using:

umi_tools extract --stdin=test.filt.fastq \
--extract-method=regex\
--bc-pattern='(?P<discard_1>TCTTACGATTACGCCAACCACTG{e<=2})(?P<umi_1>.{12})'--stdout test.processed.fastq

Any guidance is greatly appreciated!

Thank you