This is a test version of Biostars. For the public version, visit https://www.biostars.org.
UMI_extract for paired end reads of micro_RNA

I have Illumina paired end reads micro-RNA seq data (which I did not generate) that I need to analyze. I understand with micro-RNA, extracting UMI is important due to their short nucleotide length. I have no other information regarding these data apart from conditions from which the data was generated and fastq file. Evaluating the fastq file, am not sure if UMI was added to them.

Here is example of my data:

more .R1.fastq
@A00124:542:H27NNDSX5:1:1101:19262:1000 1:N:0:CCTCTAAGTA+ACTGTAACGA
NATTAGGGGAGATTTCAACTGTAGGCACCATCAATATTGGATCGTGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCTAAGTAATCTCGTATG
+
#FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFF
@A00124:542:H27NNDSX5:1:1101:20039:1000 1:N:0:CCTCTAAGTA+ACTGTAACGA
NTACGTCGAGGATTACCAGCTTGTCAAACTGTAGGCACCATCAATTGCTTGTACTGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTCTAAGTA

more .R2.fastq
@A00124:542:H27NNDSX5:1:1101:19262:1000 2:N:0:CCTCTAAGTA+ACTGTAACGA
ACACGATCCAATATTGATGGTGCCTACAGTTGAAATCTCCCCTAATAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACTGTAACGAGTGTAGATCTC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF
@A00124:542:H27NNDSX5:1:1101:20039:1000 2:N:0:CCTCTAAGTA+ACTGTAACGA
TCAGTACAAGCAATTGATGGTGCCTACAGTTTGACAAGCTGGTAATCCTCGACGTAAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACTGTAACGAG

For R1.fastq, has the 3' adapter sequence (AACTGTAGGCACCATCAAT) and Illumina Universal adapter - ‘AGATCGGAAGAG' separated by 12 random nucleotides. The R2.fastq has no such info sequences. Based on this, it seems to me that R1.fastq sequences are barcoded and not R2.fastq, is this right?

I have tried to extract UMI of these paired end sequences using UMI_tools with this code:

umi_tools extract --extract-method=regex --stdin ./Gff.R1.fastq \
--bc-pattern='.+(?P<discard_1>AACTGTAGGCACCATCAAT){s<=2}(?P<umi_1>.{12})(?P<discard_2>.+)' --read2-in=./Gff.R2.fastq \
--stdout ./output/Gff_UMIextracted.R1.fastq --read2-out=./output/Gff_UMIextracted.R2.fastq \
--log ./output/Gff_UMIextracted.log

This code ran successfully, and I got the results as below. After processing.

more R1.fastq
@A00124:542:H27NNDSX5:1:1101:19262:1000_ATTGGATCGTGT 1:N:0:CCTCTAAGTA+ACTGTAACGA
NATTAGGGGAGATTTC
+
#FFFFFFFFFFFFFFF
@A00124:542:H27NNDSX5:1:1101:20039:1000_TGCTTGTACTGA 1:N:0:CCTCTAAGTA+ACTGTAACGA
NTACGTCGAGGATTACCAGCTTGTCA

more R2.fastq
@A00124:542:H27NNDSX5:1:1101:19262:1000_ATTGGATCGTGT 2:N:0:CCTCTAAGTA+ACTGTAACGA
ACACGATCCAATATTGATGGTGCCTACAGTTGAAATCTCCCCTAATAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACTGTAACGAGTGTAGATCTC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF
@A00124:542:H27NNDSX5:1:1101:20039:1000_TGCTTGTACTGA 2:N:0:CCTCTAAGTA+ACTGTAACGA
TCAGTACAAGCAATTGATGGTGCCTACAGTTTGACAAGCTGGTAATCCTCGACGTAAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACTGTAACGAG

While there are some changes in R1.fastq file, nothing changed in R2.fastq file.

I am wondering if what I did is correct. I will appreciate if someone can validate or correct me on this.

Thank you.

umi-tools umi mirna

It helps to know what kit was used to generate these libraries, can you look at the methods section or ask your colleague? The vendor of the kit will often have guidelines for preprocessing the sequencing data.

Well, the person who was in charge of this project left the lab long time ago and not available.

No documentation, labbooks, anything?

1 answer

The UMI_tools command you specified removes a 12nt UMI, appearing after the sequence AACTGTAGGCACCATCAAT and attaches it to the read name of both read1 and read2. It also discards the AACTGTAGGCACCATCAAT, the UMI and any sequence after it.

The R2 has changed. Note that the UMIs are now present on the read name for the R2s.

more R2.fastq
                                        vvvvvvvvvvvv
@A00124:542:H27NNDSX5:1:1101:19262:1000_ATTGGATCGTGT 2:N:0:CCTCTAAGTA+ACTGTAACGA
                                        ^^^^^^^^^^^^
ACACGATCCAATATTGATGGTGCCTACAGTTGAAATCTCCCCTAATAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACTGTAACGAGTGTAGATCTC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF
@A00124:542:H27NNDSX5:1:1101:20039:1000_TGCTTGTACTGA 2:N:0:CCTCTAAGTA+ACTGTAACGA
TCAGTACAAGCAATTGATGGTGCCTACAGTTTGACAAGCTGGTAATCCTCGACGTAAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACTGTAACGAG

Whether or not this is the correct thing to do depends entirely on the design of the library preperation/library prep kit used, which is something we can't know.

Log in to answer this question.