This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Number of reads supporting a structural variant value in Dragen structural variant calling output

Hi,

I am writing because I would like to know if in the VCF output of Manta withing Dragen, if there is a way or a field value to see the number of reads supporting a structural variant, Output example from Manta user guide

chr1    11830208        MantaINS:1577:0:0:0:3:0 T       <INS>   999     PASS    END=11830208;SVTYPE=INS;CIPOS=0,12;CIEND=0,12;HOMLEN=12;HOMSEQ=TAAATTTTTCTT;LEFT_SVINSSEQ=TAAATTTTTCTTTTTTCTTTTTTTTTTAAATTTATTTTTTTATTGATAATTCTTGGGTGTTTCTCACAGAGGGGGATTTGGCAGGGTCACGGGACAACAGTGGAGGGAAGGTCAGCAGACAAACAAGTGAACAAAGGTCTCTGGTTTTCCCAGGCAGAGGACCCTGCGGCCTTCCGCAGTGTTCGTGTCCCTGATTACCTGAGATTAGGGATTTGTGATGACTCCCAACGAGCATGCTGCCTTCAAGCATCTGTTCAACAAAGCACATCTTGCACTGCCCTTAATTCATTTAACCCCGAGTGGACACAGCACATGTTTCAAAGAG;RIGHT_SVINSSEQ=GGGGCAGAGGCGCTCCCCACATCTCAGATGATGGGCGGCCAGGCAGAGACGCTCCTCACTTCCTAGATGTGATGGCGGCTGGGAAGAGGCGCTCCTCACTTCCTAGATGGGACGGCGGCCGGGCGGAGACGCTCCTCACTTTCCAGACTGGGCAGCCAGGCAGAGGGGCTCCTCACATCCCAGACGATGGGCGGCCAGGCAGAGACACTCCCCACTTCCCAGACGGGGTGGCGGCCGGGCAGAGGCTGCAATCTCGGCACTTTGGGAGGCCAAGGCAGGCGGCTGCTCCTTGCCCTCGGGCCCCGCGGGGCCCGTCCGCTCCTCCAGCCGCTGCCTCC  GT:FT:GQ:PL:PR:SR       0/1:PASS:999:999,0,999:22,24:22,32      0/1:PASS:999:999,0,999:18,25:24,20    0/0:PASS:230:0,180,999:39,0:34,0

chr1    17124941        MantaBND:1445:0:1:1:3:0:0       T       [chr1:234919886[T       999     PASS    SVTYPE=BND;MATEID=MantaBND:1445:0:1:1:3:0:1;CIPOS=0,1;HOMLEN=1;HOMSEQ=T;INV5;EVENT=MantaBND:1445:0:1:0:0:0:0;JUNCTION_QUAL=254;BND_DEPTH=107;MATE_BND_DEPTH=100 GT:FT:GQ:PL:PR:SR       0/1:PASS:999:999,0,999:65,8:15,51

I doubt it is either the PR or the SR fields. VCF fields description is there a way to infer it? Thanks

structural vcf variants manta
• 1,731 views • link
updated by benformatics benformatics • written by ieie • ieie

1 answer

Check the MANTA manual:

https://github.com/Illumina/manta/blob/master/docs/userGuide/README.md

The last column chunk with 0/1 and PASS is likely the GT and FILTER so the colon separated values are as follows:

GT  Genotype
FT  Sample filter, 'PASS' indicates that all filters have passed for this sample
GQ  Genotype Quality
PL  Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification
PR  Number of spanning read pairs which strongly (Q30) support the REF or ALT alleles
SR  Number of split-reads which strongly (Q30) support the REF or ALT alleles

So the last two are PR and SR and I’m guessing the comma separates the REF and the ALT.

• 0 views • link
written by benformatics benformatics

Thanks a lot for the answer! yes, I already saw those two fields, however I was wondering if there is a way to know the total number of reads supporting the structural variant, alternative in this case. I am doubting it is the sum of the PR and SR. What do you think?

• 0 views • link
written by ieie • ieie

Yeah it would probably be the sum.

• 0 views • link
written by benformatics benformatics

Log in to answer this question.

More posts like this
  • Manta <DUP:TANDEM> interpretation
    written by bharata1803 bharata1803
    Hi, I have this variant: chr3 129573007 MantaDUP:TANDEM:238504:0:1:0:0:0 A <DUP:TANDEM> . PASS END=129701068;SVTYPE=DUP;SVLEN=128061;CIPOS=0,4;CIEND=0,4;HOMLEN=4;HOMSEQ=GGGA;SOMATIC;SOMATICSCORE=212 PR:SR 83,0:76,0 162,60:135,66 Can someone explain, what does this mean? What is …
  • Query regarding interpretation of VCF from variant calling (SVs) using vg giraffe workflow
    written by s_135 • s_135
    I am creating a pangenome and then trying to call variants (SVs) using short read data. I proceeded with the vg tool using `vg autoindex` …
  • Structural Variants (SV) Manta output interpretation
    written by aLex97 • aLex97
    Hi everyone, I ran variant calling using Manta (the SV caller) with both my tumor and normal BAM files. I checked the results in somaticSV.vcf.gz. …
  • Manta: What does all this mean
    written by josh.mannheimer • josh.mannheimer
    Hi, I am trying to understand these Manta somatic variant VCFs that I have annotated with VEP. chr10 11974892 MantaBND:6118:0:1:0:0:0:0 G ]chr1:41850074]G . PASS SVTYPE=BND;MATEID=MantaBND:6118:0:1:0:0:0:1;CIPOS=0,2;HOMLEN=2;HOMSEQ=AG;SOMATIC;SOMATICSCORE=54;BND_DEPTH=62;MATE_BND_DEPTH=0;CHR2=chr1;ENDPOSSV=41850074;SVLEN=0;RO=-+;TRA;LENSV=-1;RGENUPS=ENSCAFG00000045430___None,-9947,+;RGENISEC=ENSCAFG00000000435___BEST3,0,-;RGENDNS=ENSCAFG00000000436___RAB3IP,59491,+;LGENUPS=ENSCAFG00000000405___PLEKHG1,-146330,+;LGENISEC=ENSCAFG00000000413___MTHFD1L,0,+;LGENDNS=ENSCAFG00000000419___AKAP12,173336,+;CSQ=]chr1:41850074]G|feature_truncation|HIGH|MTHFD1L|MTHFD1L_3|Transcript|XM_038526323.1|mRNA||||||||||||1||||Canis_familiaris.UU_Cfam_GSD_1.0.gtf.gz|,]chr1:41850074]G|feature_truncation&intron_variant|HIGH|BEST3|BEST3_2|Transcript|XM_038549568.1|mRNA||4/5||||||||||-1||||Canis_familiaris.UU_Cfam_GSD_1.0.gtf.gz| …
  • FORMAT column with GT for somatic SV VCFs
    written by Christian • Christian
    Hi, I have done tumor-only somatic structural variant (SV) calling with Manta. This results in several VCFs with candidate variants. However, some of these do …
  • How to interpret deletion the length of chromosome?
    written by optimistsso4co3 • optimistsso4co3
    I called structural variants with MANTA, merged with SURVIVOR for 600 samples. And get thousands of Deletions that basically span the entire chromosome and even …
  • Editing Manta structural VCF file
    written by parvathi.sudha • parvathi.sudha
    Hi, Is there a way for filtering/removing the structural variants identified in ChrUn and other random contigs or in non-main chromosomes? I am using hg38 …
  • Filtering multiple single person structural variant VCF files by type of SV
    written by tacrolimus tacrolimus
    Dear Biostars community, Pretty similar question to my last one (https://www.biostars.org/p/401741/#401745) but with a twist! I have 100 VCF files each a "structural" VCF file …
  • calling deletions and duplications in the cancer genomes
    written by Bogdan Bogdan
    Dear all, please could you help with the interpretation of the following finding: I have being using several SV callers (including MANTA) to call structural …
  • problems with pindel2vcf output
    written by d.esser • d.esser
    Dear all, I used Pindel v 0.2.4d for calling structural variants. I tried to convert the output to vcf with the following command: pindel2vcf -p …