Are there any tools that support wobble-base pair alignment? · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Are there any tools that support wobble-base pair alignment?

I have a requirement:
I have an siRNA sequence about 17 nt in length, and I want to perform alignment at the transcriptome level to identify off-target sequences (sequences with up to 3 mismatches). I would like G-T wobble-base pairs not to be considered as mismatches. Is there a tool that can achieve this? Currently, my idea is to replace G with A and T with C in the siRNA sequence and use Bowtie for sequence alignment.

Thanks!!!

pair wobble-base

• 522 views • link

written 1.6 years ago by Renqing •

0 answers

No answers yet.

Log in to answer this question.

More posts like this

Best practice to find break point in fusion genes
written 4.4 years ago by pablo

Hello, I work on Pacbio Isoseq data, on A. thalina genome. I need to find the fusion transcripts and the break point of the fusion. …
Alignment with inserts and keeping the indexing of ref seq intact
written 4.9 years ago by iamakhilverma •

Parts of sequences are given below- **Reference sequence (pre-alignment):** ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT **Reference sequence (post-alignment)** and below it is **Sample sequence (post-alignment)**: --------------------------------------------------------------------------------------------------attaaa---------ggtt------------------tataccttc---------ccaggtaacaaa-------------ccaacc-----aactttcgatctcttgtagatctgttctctaaacgaactttaaaatctgtgt --------------------------------------------------------------------------------------------------------------------------------------------------------------taacaaa-------------ccaacc-----aactttcgatctcttgtagatctgttctctaaacgaactttaaaatctgtgt I'm adding a …
Dotplots and weight matrices for quality assessment
written 7.5 years ago by rah •

Im doing different analysis using dotplots in a project. 1) First im comparing a sequence read (in fastQ format) to a reference genome, in order …
Bowtie alignment of piRNAs to find potential targets
written 8.1 years ago by mujupas

Hi, I have a set of piRNAs in fasta format and I want to find their potential targets. According to literature nucleotides in position 1-10 …
How to identify the SiRNA abundance from transcriptome data
written 8.9 years ago by akilabioinfo •

Hi all, I am having transcriptome data of c.elegans i would like to analyse the differential expression of siRNA between wild and mutant type. Is …
Finding a genetic sequence with no homology in a target genome
written 12.1 years ago by Ali

<p>I want to design a probe, a short DNA sequence, with no homology in a target sequence. By homology I mean the designed sequence has …
Python- Function To Compare A Sequnces In Multisequence Fasta
written 12.4 years ago by st.ph.n

<p>I'm trying to write a python script, given a fasta, with multiple records, to count the number of matches and mismatches, excluding gaps. The fasta …
Assessing Whether Point Mutations Introduce Stop Codons Into Chromosomal Dna Using Ensembl And R
written 14.2 years ago by Alexander •

**Problem**: I have a spreadsheet that contains a list of mostly point mutations in a particular type of cancer. The sheet has columns that correspond …
Bioperl Sirna Design
written 15.2 years ago by User 3992 •

<p>Plz help me in the following code.Where is the $bio_seq. I am new to this area plz help. How can i run the code???? Its …
Consensus Sequence
written 15.8 years ago by User 5217 •

<p>Hello, I have below 8 sequences and I would like to calculate a consensus sequence from them.</p> <pre><code>sequences = [['C', 'C', 'C', 'A', 'T', 'T', …