This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Question about seqkit sort function

Hi everyone, I need to use seqkit sort option to sort a multifasta file by its sequences name. I've been using seqkit sort -N multifasta.fa. However, I've noticed that this command adds a separator between the sequences (--). Anyone knows why is this happening and how to avoid it?

Thanks in advance!

fasta multifasta seqkit
• 1,244 views • link
updated by shenwei356 shenwei356 • written by FJCF • FJCF

I just tested this but I don't see the separator being added. In fact if I add separators manually they are appended to the end of the sequence they follow, like so

GTTTTGGAGGAAAAAAAATACAAGTAGCATTTACAACAGCTCTTTGCTCTTTAAATTTCT
TACCATTCAATAAAGTGATCCAGTCACTCACATTTGAACTGA------------------
-------------
• 0 views • link
written by GenoMax GenoMax

-- between sequences should be there before using seqkit sort, which just changes the order rather than the content.

You can check it by searching sequences with -.

seqkit grep -s -r -p -- multifasta.fasta
• 0 views • link
written by shenwei356 shenwei356

0 answers

No answers yet.

Log in to answer this question.

More posts like this