This is a test version of Biostars. For the public version, visit https://www.biostars.org.
PolyA tail trimming in Nanopore Direct RNA Sequencing reads

Hello everyone,

I am working with Nanopore DRS data and trying to find out the Alternative Polyadenylation between samples.

For better alignment I have to go for polya tail trimming of the reads, but they dont have consistent A tails as we see in NGS reads. Can anyone suggest how to go for trimming of the DRS reads.

nanopore apa
• 1,602 views • link
written by baibhu1234 • baibhu1234

1 answer

You should be able to use fastplong (LINK) or new polyfilter.sh tool from BBMap suite (New Illumina error mode, new BBTools release (39.09) to deal with it )

• 0 views • link
written by GenoMax GenoMax

I am not able to decide the list of adaptors which can be trimmed from my DRS fastq file as reads in my case are having irregular Tails with no pattern. for example, following are the 3'end of first few reads

CACAUGCUCGGUGAACACAAACUUUAAAUAUAAAUCUUGCUUGUUCAAAAAAAAAAUCC GAAUAUUGUUGACAGCUGCUAUUAUUUUUAAUCUUGUAGUAUUUGGCAAAAAAAAAAAAUC AACUGAUGUGAUGCCAUAAUAGUAAAAAAAAAAAAAAAAAAAAAA UGAUGCCAUAAUAGUAAAAAAAAAAAAAAAAAAAAAA AGAACAAUUCAUUGUCAUGACAUUCAUUCAAAAAAAAAAUA UAAAAAUCCUAUGUGUUGCAUGCUGAUCUCAUUUCUCAAAAAAAAAAAAAAAAAAAAAAUCC UCAGUGUUCAAAAUGGCCUGUUUGUUUAAAAAAAAAAAAAAAAAAAAAAAAAU GAGGAGAAAGAAAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGAGGAGGGGA

Can anyone suggest what can i do to remove the Tails from my reads, so that i can have more accurate PolyA site identification.

• 0 views • link
written by baibhu1234 • baibhu1234

Log in to answer this question.

More posts like this