cellranger count error:
i met a problem when running cellranger count for a sample: The read lengths are incompatible with all the chemistries for Sample "SRR12234211_GSM4673007_Donor_2_iNOA_fastq".
- read1 median length = 28
- read2 median length = 0
- index1 median length = 0
The minimum read length for different chemistries are:
SFRP - read1: 26, read2: 30, index1: 0
SC5P-R2 - read1: 26, read2: 25, index1: 0
SC5P-PE - read1: 81, read2: 25, index1: 0
SC3Pv1 - read1: 25, read2: 10, index1: 14
SC3Pv2 - read1: 26, read2: 25, index1: 0
SC3Pv3 - read1: 26, read2: 25, index1: 0
SC3Pv3LT - read1: 26, read2: 25, index1: 0
SC3Pv3HT - read1: 26, read2: 25, index1: 0
it seems that something wrong with R2.fastq, but when i check this file:
zcat SRR12234211_GSM4673007_Donor_2_iNOA_S1_LOO1_R2_001.fastq.gz | head
@SRR12234211.1 1/2
CAAAAGGAAAGACCNCATCTNNACNNGANNNNNANNNGNNNNNNTNNNANNGNNNNNACNANNNNANNNNTNNNNANNNNNCNNNNANANNNANNNNNNN
+
AAAA////6EE/6E#AAAAE##EA##AE#####E###/######/###E##/#####/<#A####/####/####/#####/####<#/###/#######
@SRR12234211.2 2/2
TTAATTGAGAGTGGNAGGATGNAANNATNNNNNTNNNANNNNNNTNNNANNTNNNNNACNGNNNNANNNNANNNNTNNNNNTNNNNTNANNNANNNNNNN
+
AA6A6E///<////#///A//#//##/E#####/###/######/###/##/#####/A#/####<####/####/#####/####6#/###/#######
@SRR12234211.3 3/2
GACAGACTTAGACATATTGGGGCAGTTTTTAAATATCCTGAAGTAAAAGGTGACAAGAAGACATTTTAAGAACATTTATTGAATTCCAATATAAATATTC
and the size of R1,R2files are correct i already redownloaded twice
my script:
cellranger count --localcores=8 --id SRR12234211_GSM4673007_Donor_2_iNOA --transcriptome gtf/01.10X_cellranger/human/GRCh38/ --fastqs SRR12234211_GSM4673007_Donor_2_iNOA_fastq/ --sample SRR12234211_GSM4673007_Donor_2_iNOA > SRR12234211_GSM4673007_Donor_2_iNOA.CellRanger.log 2>&1
i am newbie please help me orz :(
• 2,116 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Are you getting an error when you try to run the files through
cellranger? Your files are not in the Illumina fastq header format (since you likely did not dump them using -F option). Looking at the metadata R1 (28 bp) and R2 (100 bp) are relatively correct read lengths: https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&acc=SRR12234211&display=metadataWhere did you get that table? This appears to be a simple 10x 3' library.
thank you for replying!! this is R1file:(16barcode+12UMI):
this is my R2 file:
i think both length are correct?
These files look correct.
and that table appears in my error log
Looks like for some reason
cellrangeris not able to recognize the R2 file. Are both files in the folder you are providing tocellarager?and i just found a bug..don't know if it is the reason... i tried to use zcat to check the read length of R1: $ zcat SRR12234211_GSM4673007_Donor_2_iNOA_S1_LOO1_R1_001.fastq.gz | head -n 8 when copy the command to check R2 by substituting 'R2' character 'R1',it didnot work!! $ zcat SRR12234211_GSM4673007_Donor_2_iNOA_S1_LOO1_R2_001.fastq.gz | head -n 8 No such file or directory it's really confusing...because the only difference between these two file names is the number 1/2
What that means is the file is not there. Check with
ls -l SRR12234211_GSM4673007_Donor_2_iNOA_fastq/.I notice that you are using relative paths. So hopefully where ever you are running the
cellrangercommand from has the above directory present in it.omg...i know the reason!!! the character 'L001' in R2 file name was written in 'LOO1'!!!!how dare me .......... thank you a lot!!!!!!!!!!!!!!!!!!!!!