This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Telescope issue

Hello I am using HISAT2 aligned files to look at transposable elements. I am running the command

telescope assign output/hisat2_output.sam hg38.k113.gtf --outdir tele_out --updated_sam

but i keep getting this error

[E::sam_parse1] CIGAR and query sequence are of different length [W::sam_read1] Parse error at line 9954941

Traceback (most recent call last):
File "/opt/anaconda3/envs/telescope_env/bin/telescope", line 11, in <module>
load_entry_point('telescope-ngs==1.0.3', 'console_scripts', 'telescope')()
  File "/opt/anaconda3/envs/telescope_env/lib/python3.7/site-packages/telescope/__main__.py", line 95, in main
args.func(args)
 File "/opt/anaconda3/envs/telescope_env/lib/python3.7/site-packages/telescope/telescope_assign.py", line 216, in run
ts.load_alignment(annot)
File "/opt/anaconda3/envs/telescope_env/lib/python3.7/site-packages/telescope/utils/model.py", line 161, in load_alignment
maps, scorerange, alninfo = self._load_sequential(annotation)
  File "/opt/anaconda3/envs/telescope_env/lib/python3.7/site-packages/telescope/utils/model.py", line 230, in _load_sequential
for ci, alns in alignment.fetch_fragments_seq(sf, until_eof=True):
 File "/opt/anaconda3/envs/telescope_env/lib/python3.7/site-packages/telescope/utils/alignment.py", line 150, in fetch_fragments_seq
for alns in b_iter:
File "/opt/anaconda3/envs/telescope_env/lib/python3.7/site-packages/telescope/utils/alignment.py", line 119, in fetch_bundle
for aln in samiter:
File "pysam/libcalignmentfile.pyx", line 2195, in pysam.libcalignmentfile.IteratorRowAll.__next__
OSError: truncated file

and the only out put i get is a .bam file and no .tsv. Please help-- Thank you!

telescope rna-seq

CIGAR and query sequence are of different length [W::sam_read1] Parse error at line 9954941

Problem appears to be at that line. Can you post the output of

sed -n '9954941p' your.sam

Hello the output is

A01940:33:GW2208142379th:3:1317:24126:3505  355 chr14   16651125    0   150M    =   17034150    122900  GCTAACAGAGTTGAACCTTTCTATTGACAGAGCAGTTTTGAAACAGTCTTTCTGTGGAATCFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF    AS:i:-5 ZS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:88A61  YS:i:-8 YT:Z:CP NH:i:2

Thank you!

Looks like there is a tab missing between the sequence and the quality string.

Thank you! how would I correct that?

You could edit the SAM file but I wonder if this problem is present in your original fastq data file so if not inconvenient do the alignment again and see if that fixes the issue.

You did not get any errors when you did the alignment?

0 answers

No answers yet.

Log in to answer this question.