I am new to RNA-seq data processing. I have my data from NCBI (link below). I am having a problem with making sense of my fastq file and report. As shown below I have my two paired end reads results each 127 bp in length however my results on the fastq report shows 91 and it does not show the inter-quartile range (box-whisker plot), what could be the problem?
fastq file
@SRR20708369.1 NS500749:581:HGV7VBGXB:1:11101:17225:1048 length=127
AGCTATCACAGCANGGTACTTCCCAGCGTTACGGGANTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCAACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCCACCATTAACC
+SRR20708369.1 NS500749:581:HGV7VBGXB:1:11101:17225:1048 length=127
A6AAAE6EA/AAA#EAEAEEEAEEEE/EAEEEEA<E#AAAAEEEE6E<E//EE6EAEEAEAEE/AAA6E//E/EE/A<AEEEE/AEEE//<EEA/EE/E/6<<EE<EEE/<EEEEE//<AE/AAEA/
fastqc report of the sample:
You created multiple posts on multiple sites for the same question. That is bad etiquette and only serves to annoy people in both communities. Remember you're asking volunteers in two places to spend their time on you while not telling them that you've asked another set of volunteers as well. You're not getting quotes from competing businesses, you're wasting volunteers' time. Please do not repeat this in the future.
Link to cross-post: https://bioinformatics.stackexchange.com/questions/22008/
I appreciate your feedback, and I apologize if my approach was inappropriate. I genuinely didn't intend to inconvenience anyone. Thank you for bringing this to my attention. I'll make sure to avoid such practices in the future and respect the community guidelines.