Filling gaps in BAM file
Hi! I have BAM files that contain fairly large numbers of gaps due to the fact they are aDNA data. The BAM files have EOFs and look like this (only a snippet shown below):
11:57001065-57004724
SN7001204_0523_AHJLV3BCXX_R_PEdi_L5727_37_1:1:1106:9922:91821c 16 11 57000970 37 113M * 0 0 TTCTCTTTACGGCTTCCCCCTCACCATGCTGAAACATTTGCAAGCTGGAGGTTATCCCAAGACACTTTCATGAGAAGAGGCTTTGGACACAACAGTTGCACAAACAGTTTTAT ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] X0:i:1 X1:i:0 XT:A:U RG:Z:L5729 XI:Z:AGCAATC XJ:Z:CATGCTC YI:Z:DDDDDII YJ:Z:DDDDDII NM:i:0 XP:i:2 MD:Z:113 FF:i:2 Z0:i:0
D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:7:1312:3759:89487 0 11 57000990 37 125M * 0 0 TTACCATGCTGAAACATTTGCAAGCTGGAGGTTATCCCAAGACACTTTCATGAGAAGAGGCTTTGGACACAACAGTTGCACAAACAGTTTTATTTGATGAACCACAGTGACTAACAGGATCAGAA B@BBBFGGGGCFGGGGGGGEGGGGGEGFGEGDGGGGFEGGGGGGGGGGG]]]]]]]]]]]]]]]]]]]]]]]]]]]GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCCBCC XI:Z:ATCATAA YI:Z:A@A<A;B XJ:Z:AATAGTA YJ:Z:333<<>F FF:i:2 Z0:i:0 XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:1C123 RG:Z:L5832
SN7001204_0528_BHJL5LBCXX_R_PEdi_L5727_37_6:1:2214:18489:14905 0 11 57001002 37 86M * 0 0 AACATTTGCAAGTTGGAGGTTATCCCAAGACACTTTCATGAGAAGAGGCTTTGGACACAACAGTTGCACAAACAGTTTTATTTGAT DDDDDIIIII]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]IIIIIDDDDD XI:Z:TTAATAG YI:Z:DDDDDII XJ:Z:GTCCGGC YJ:Z:DDDDDII FF:i:2 Z0:i:0 XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:12C73 RG:Z:L5728
D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:5:2213:11747:60758c 147 11 57001005 60 76M = 57000916 -165 ATTTGCAAGCTGGAGGTTATCCCAAGACACTTTCATGAGAAGAGGCTTTGGACACAACAGTTGCACAAACAGTTTT ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]W]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]][T X0:i:1 X1:i:0 XT:A:U RG:Z:L5831 XI:Z:CCTAACG XJ:Z:CAGTACT YI:Z:BBBCCGD YJ:Z:BBBBCGG AM:i:37 SM:i:37 NM:i:0 XP:i:2 MD:Z:76 Z0:i:0
D00829_0050_BCADRUANXX_PEdi_VS_L5848_L5851_1:2:1207:14230:77955c 16 11 57001005 37 86M * 0 0 ATTTGCAAGCTGGAGGTTATCCCAAGACACTTTCATGAGAAGAGGCTTTGGACACAACAGTTGCACAAACAGTTTTATTTGATGAA ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] X0:i:1 X1:i:0 XT:A:U RG:Z:L5848 XI:Z:GCCATGC XJ:Z:AACCAAG YI:Z:BB@BBGE YJ:Z:@BBABGG NM:i:0 XP:i:2 MD:Z:86 FF:i:2 Z0:i:0
There are clearly gaps here, but I really need no gaps for the pipeline I'm trying to run (protein structure analysis).
I would like to fill these gaps with a human reference sequence (which I already have), and keep a record of how much of the BAM file gaps are filled with the reference sequence.
How would I go about doing this? Thank you!
• 1,863 views
•
link
0 answers
No answers yet.
Log in to answer this question.
aDNA = ancient DNA? By "gaps" do you mean sections of a reference assembly where no reads overlap? How do you detect the gaps? I can imagine identifying gaps, grabbing tiles from the reference assembly, and making up fake reads with unique read IDs that you could merge with your existing BAM file. This would be fairly easy to do with R (GenomicRanges library, Biostrings, etc.) but could also be done a number of other ways. What tools do you prefer?
aDNA = ancient DNA. By gaps, I think I mean just sections of the genome where there was not sufficient coverage or data to produce reliable reads for the BAM file. I'm very open to using any tools - but I do have some proficiency in R! I'm not sure how to take the 'tiles' from the reference assembly and merge them with my existing files. I do need the read IDs to fit into the gaps in the BAM file however. Thank you for your time!
A solution that involves making up reads to look like something else feels a bit wrong. Sounds like a so-called XY problem:
https://xyproblem.info/
that goes like this:
I would recommend that you state the original problem rather than coercing a nail to fit a hammer.
Perhaps what you need is a consensus sequence, or perhaps what you need is something else altogether.
Backfilling the entire genomic DNA with made-up reads, where the goal primarily is to perform protein analysis, feels like a stretch.
After all, a single indel mistake, a single splicing signal error, would propagate down and alter the entire protein sequence!
I sort of want to draw a picture to verify what you have, and I worry you might be stuck in XY space as Istvan Albert points out. At the moment we have only words, so we must be precise. I want to know that (1) you have DNA reads from a sample, and (2) you have a reference genome you used to align those reads. Is this correct? The definition of a BAM file is an alignment map between reads and a reference. Your question implies there are contiguous sections of the reference where no reads from your sample map to, and that you'd like to generate reads from the reference to fill in this space. Given that you're working with ancient DNA I would guess you want to do some kind of structural analysis comparing ancient sequence to modern (i.e. your reference genome). (I hate guessing, but if so, why not map your reads to the reference to do variant analysis, and then insert the variations into the gene sequences from the reference? There are methods for altering sequences given a file of variation from the reference).