Can anyone explain the following tags from BWA sam output.
GA004_0001:5:1:1073:12995#0 0 chr10 135119228 37 75M * 0 0 CTGGGTTTGGCATAGTGGGAGGGCAGGCAGGGGTGGTTTTCCTGGCTACTCAGGGTTGCAGAGGACAGGACCGA
A CCCBCCCBCBCCC=CCCCCCCC@@BCCCCCCBC?C>=CCACAC@A+?;<;BAA@A08A++?6?<9ACCC68=C8< XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:45A29
How to check whether a tags in unique hot or multiple hits as sam flag is bit confusing to read. Thanks.
2 answers
Here and in more details here, you can find a good description of the SAM/BAM standard and what all fields mean. There is also a page with predefined tags and it says how you can make your own.
Those starting with X,Y and Z are "reserved for end user" Maybe an intermediate program?
NM:i:1 Number of nucleotide differences
MD:Z:45A29 String of mismatching position
I don't quite understand when you say "tags in unique hit or multiple hits"
Multiple vs unique hits are encoded in a numerical form.
For checking just one flag: http://picard.sourceforge.net/explain-flags.html
For checking multiple tags on a command line: http://picard.svn.sourceforge.net/viewvc/picard/trunk/src/scripts/explain_sam_flags.py
Just collect all unique tags from your SAM file and see what you got there first.
See also "SAM format parsing / stats" post
Log in to answer this question.
-
How "bases mapped (cigar)" value in samtools stats is calculated?
written by Tian •
-
splitting a bam file by XA tag into multiple lines
written by erl1977 •
-
extract discordant,split reads from BAM file
written by 9521ljh •
-
Get gene counts from *.sam file and annotation
written by tim.ivanov.92 •
-
Trimmed NGS exome data failed to be mapped with bwa
written by yanqiangchang •
-
Can't convert paired end BAM to bed using bedtools
written by colin.kern
-
Counting mapped reads from a SAM file
written by kobipe3 •
-
BWA: improper orientation but listed as properly paired
written by richard.deborja
-
Why Does This The Sam Record Having A Mapping Quality Of 0
written by huskerjeff492 •
-
Igv Not Recognizing Samtools Sorted And Indexed Files.
written by joaslucas •
XT:A:U means unique and XT:A:R means repeats. What are the other X:?:? tags used. Please explain.