This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Igv Not Recognizing Samtools Sorted And Indexed Files.

Hi Everyone, I have a Bacterial RNA-seq data, I aligned it against the bacterial genome (BWA) and I got the following SAM file bellow ( I also have it as a BAM file).

@SQ    SN:gi|448814763|ref|NC_000962.3|    LN:4411532
H-161:169:c10paacxx:2:1101:1165:1975    0    gi|448814763|ref|NC_000962.3|    1471730    37    50M    *    0    0    TTTTGTTGTTATTTTTGGCCATGCTCTTGATGCCCCGTTTCCGGGGGCGT    ?@@FDADDDFFBHFEEDHFDHAGBHC@EGFDEHGG;:?BB900?D@####    XT:A:U    NM:i:2    X0:i:1    X1:i:0    XM:i:2    XO:i:0    XG:i:0    MD:Z:39G0T9
H-161:169:c10paacxx:2:1101:1733:1923    0    gi|448814763|ref|NC_000962.3|    1471725    37    50M    *    0    0    NACATTTTTGTTGTTATTTTTGGCCATGCTCTTGATGCCCCGNTGTCGGG    #4=DDFFFHHHHHJJIJJJJJIIJJJJJJJJJJIJJJJJJIJ#0?BFHGG    XT:A:U    NM:i:2    X0:i:1    X1:i:0    XM:i:2    XO:i:0    XG:i:0    MD:Z:0C41T7
H-161:169:c10paacxx:2:1101:4221:1950    0    gi|448814763|ref|NC_000962.3|    1473571    37    50M    *    0    0    CTGGATAGTGGTTGCGAGCATCAATGGATACGCTGCCGG

I would like to open it on IGV, but run into a problem. It says that the index file that I generated from samtools is not recognized. When I use the sorted file (from samtools too) and the IGV tries to generate an index file, it now says that th sorted file input (from samtools) has to be sorted by start position

org.broad.igv.sam.reader.UnsortedFileException: File must be sorted by start position. Sort test failed at: H-161:169:c10paacxx:2:1101:7106:1965 0 gi|448814763|ref|NC_000962.3| 1471717 37 50M * 0 0 GGTGGTTTCACATTTTTGTTGTTATTTTTGGCCATGCTCTTGATGCCCCG CCBFFDFFHHHHHJJJJJJJJJJIJJJJJIJJJJJJJJJJJIJJIJJJJI XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50

Hoe do I get they sorted by the start position?

Thanks

igv bwa samtools

How do I get they sorted by the start position?

samtools sort

3 answers

As the error says your file is not sorted by position. Sort it, then index it and all will be fine.

samtools sort somefile.bam newfile
samtools index newfile.bam

samtools sort somefile.bam > newfile

You should really be sorting your bam file samtools sort and then indexing that file samtools index. The default sort order is coordinate, which sort by contig name and then read start position.

Try the sort and index the sam file.

Log in to answer this question.