Dear all, I have 150bp paired-end mRNA data, for one sample in the reverse reads (R2) file the QC (FastQC) run for upto 95 % and then failed with an error message:
Failed to process file Sample1-mRNA_R2.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Ran out of data in the middle of a fastq entry. Your file is probably truncated
I have tried to print the tail of the file using the following command:
zcat ISample1-mRNA_R2.fastq.gz | tail -1
and got the following output:
gzip: Sample1-mRNA_R2.fastq.gz: unexpected end of file
AGGCGTATCTCACTGACTTCCTGTGTCAGTTTGCACAGCAGCCCTGCTATGCCATGTTTTCAGACCATCTCAATGAGAATGAAAAGCGAGTGCTGCAGGCCATTGGCAT
The file seems to be truncated but we do not have any other source available as the sequencing was done in 2017 and we only have this version of the file available.
Is there a way to process the truncated fastq file for the differential gene expression analysis?
•
written
by
waqaskhokhar999
1 answer
Is there a way to process the truncated fastq file?
Once data is compromised in some way you can't be totally sure of the results. That said you could use repair.sh from BBMap to remove singleton reads and bring the two files in sync. You will lose some data but the remainder can be used.
repair.sh -Xmx4g \
in1=R1.fastq.gz \
in2=R2.fastq.gz \
out1=R1.repaired.fastq.gz \
out2=R2.repaired.fastq.gz \
outs=singletons.fastq.gz \
repair
Log in to answer this question.
-
samtools index: failed to create index. ([E::hts_idx_push] NO_COOR reads not in a single block )
written by DareDevil
-
How to retrieve fastq files from NCBI using SRA accessions?
written by v.berriosfarias •
-
spades.py Error 255
written by Scottie •
-
Use cat to sort multiple fastq files in a directory
written by dzisis1986 •
-
Fastqc genome reads
written by Ak •
-
gzip: merged.fastq.gz not in gzip format
written by Kai_Qi
-
bbduk truncated fastq file according to FastQC - help?
written by lintonf •
-
Failure in generating fastq from human fasta
written by marongiu.luigi
-
tophat: qual length error after trimming
written by zz105 •
-
Fastq file is truncated error message
written by rob.costa1234
