How to correct the position of my primers
I have been having issue getting my primers to match the expected output. For instance the bases of the first primer starting on the left are off by 4 base pairs to the right of the correct position.
This is what I am suppose to get: ttggcagttgggaccgttta This is what I am getting cagttgggaccgtttattcg
If you look at a bit of the nuclitide sequence ctaataactgtcggt[ttgg[cagttgggaccgtttattc I market in brackets where the primer should start and where it actually starts. Here is my code:
import argparse, pdb
import subprocess
from pyfasta import Fasta
# Create the argument parser
parser = argparse.ArgumentParser(description="Automatic Primer Identification")
parser.add_argument("Fasta_filename", help="the name of a fasta file", type=str)
parser.add_argument("Chromosome_of_interest", help="The chromosome we want to amplify", type=str)
parser.add_argument("Position_of_amplification", help="Position we want amplified", type=int)
#parser.add_argument("--product_length", type=int, default=700, help="Product length (default: 700)")
args = parser.parse_args()
# Open the fasta file and read in the sequence
F = Fasta(args.Fasta_filename)
# Identify the sequence 500 bp upstream and downstream of the requested position
req_seq = F[args.Chromosome_of_interest][args.Position_of_amplification - 500:args.Position_of_amplification + 500]
# Add braces to the DNA sequence 100 bp upstream and downstream of the requested position
# Create an input file containing the DNA sequence and specify a product length of 600 - 800 base pairs
with open('input.txt','w') as f:
f.write("SEQUENCE_ID=test""\n")
f.write("SEQUENCE_TEMPLATE="+req_seq+"\n")
f.write("PRIMER_PICK_LEFT_PRIMER= 1"+"\n")
f.write("SEQUENCE_TARGET=400,600\n")
f.write("PRIMER_PICK_RIGHT_PRIMER=1"+"\n")
f.write("PRIMER_PRODUCT_SIZE_RANGE="+"600-800"+"\n")
f.write("SEQUENCE_INTERNAL_EXCLUDED_REGION="+'400'+","+'600'+"\n")
f.write("=\n")
f.close()
#print(F[args.Chromosome_of_interest])
# Execute the primer3_core command on the input file you created
# primer3_command = ["primer3_core", "primer.txt"]
primer3_command = 'primer3_core < primer.txt'
subprocess.check_output(primer3_command, shell=True, encoding = 'utf-8')
# Read in and parse the output to identify the sequence of the best two primers
output = subprocess.check_output(primer3_command, shell=True, encoding = 'utf-8')
primer_output = output.split('\n')
best_primers = []
for i, line in enumerate(primer_output):
if line.startswith("PRIMER_LEFT_0_SEQUENCE="):
best_primers.append(line.split('=')[1])
elif line.startswith("PRIMER_RIGHT_0_SEQUENCE="):
best_primers.append(line.split('=')[1])
if len(best_primers) == 2:
break
# Print the best two primers to the user
for i, primer in enumerate(best_primers):
print(f"{primer}")
I don't know if the issue has to do with the FASTA file or the file I created to import my results into. I've been at this for awhile, please any help will be appreciated.
• 694 views
•
link
0 answers
No answers yet.
Log in to answer this question.