Your code looks mostly correct for calculating the distance between k-mer instances in a sequence. However, there are a couple of minor improvements that can be made.

1. Importing pairwise from itertools: In your code, you have imported the pairwise function from itertools correctly. However, you're not utilizing it in the code. To calculate the distance between consecutive elements in the starts list, you can directly use the pairwise function like this:

from itertools import pairwise

dist = [j - i for i, j in pairwise(starts)]

This eliminates the need for an additional loop to calculate the distances manually.

1. Variable name conflict: There is a variable name conflict in your code. You have used di both as a parameter for the function and also within the loop. This can cause confusion and potential errors. It's better to rename the variable inside the loop to something different, such as subseq or current_kmer, to avoid conflicts.

Taking these improvements into account, here's the updated version of your code:

from itertools import pairwise

seq = "ACCGGCTTTAACGGCCTACGCGTTTTAAGCCGG"
di = "CG"

def get_inter_kmer_distance(seq, kmer):
    lk = len(kmer)
    starts = []
    for i, _ in enumerate(seq):
        subseq = seq[i:i+lk]
        if subseq == kmer:
            starts.append(i)
    dist = [j - i for i, j in pairwise(starts)]
    return dist, starts

distances, starts = get_inter_kmer_distance(seq, di)
print("Distances between k-mer instances:", distances)
print("Start positions of k-mer instances:", starts)

This updated code should give you the correct distances between k-mer instances and the start positions of each k-mer instance in the sequence.