This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Problem with homer in findMotifs.pl when using input and bg fasta

I am using the following command:

findMotifs.pl input.fa fasta ./Output -fastaBg bg.fa -len 8,10,12 -norevopp

The input and bg fasta have this structure and the bg fasta include all sequences in input plus many others:

>ENSMUST00000027125_Coq10b_mmu_chr1_55071635_55072702_+_utr_55071803_55072702(+)

ATTTCTTTTGAATTCCGCTCCCTTCTGCACTCTCAGCTCGCTACTCTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGC AGCCTTTGAAAGAAGAGCCTGTAAACTGTATGGTCCAGAGACAAACATACCTCGGGAATTAATGCTTCATGAAATTCACC ACACCTAAGAGGAAAATATTAGCTGCCTCCACCTACTCTTGGCTAGTTTGTTCACTTCTAGGAAGTCCTTTTACCATCTG` TTGAGAAGTCAGAAAGCATTTGTTAAACCTGCCTTGATTCTAAGCCCGTGCTGTTGAAAATTTGCACATTGAACATGGAC CCACTTGTACATAGAATTATTTCTTCAATCAAGTGTGACTCTAAGTATCATGTACATTTGCAGGCTCCGACCACCTTTGT AATAACGGATGTCATCACTGTTGCTAGGATACCACATTCCTCGTTTGAGTGTACAGATGAACAAGTCTTTTAATTCTCAC CTTACATGAAAAGGTTAGCTGAGATACAATGTGTGTTATATTAACCATATCATGTTTAAGTTATTAGGTTCAGAGTATTT GTAACTTATTGTTATTCGGCATGCCATATGGCTTAGGGTATTTGAATAATCATATATTTACCATTAAAACTGTGATTTAA AGTATTGCTAATGAAGTCTTAGCACTTTGGGTATTTTAATTGTTCTTATGGGTAGCAGTAGATGATTCAGTGTTGTTGGG

However I get the following error:

Selected Options:
Input file = input.fa
Promoter Set = fasta
Output Directory = ./CPEB4
Will use FASTA files for motif finding
    Target Sequences = input.fa
    Background Sequences = bg.fa
Motif length set at 8, 10, 12, 
Will not search the reverse strand
Using custom gene IDs for GO analysis
Parsing FASTA format files...

Progress: Step4 - removing redundant promoters

Progress: Step5 - adjusting background sequences for GC/CpG content...

Sequences processed:
    0 total

Frequency Bins: 0.2 0.25 0.3 0.35 0.4 0.45 0.5 0.6 0.7 0.8
Freq    Bin Count

Illegal division by zero at /software/HOMER/bin/assignGeneWeights.pl line 63.

Normalizing lower order oligos using homer2

Reading input files...
0 total sequences read
Autonormalization: 1-mers (4 total)
    A   inf%    inf%    -nan
    C   inf%    inf%    -nan
    G   inf%    inf%    -nan
    T   inf%    inf%    -nan
Autonormalization: 2-mers (16 total)
    AA  inf%    inf%    -nan
    CA  inf%    inf%    -nan
    GA  inf%    inf%    -nan
    TA  inf%    inf%    -nan
    AC  inf%    inf%    -nan
    CC  inf%    inf%    -nan
    GC  inf%    inf%    -nan
    TC  inf%    inf%    -nan
    AG  inf%    inf%    -nan
    CG  inf%    inf%    -nan
    GG  inf%    inf%    -nan
    TG  inf%    inf%    -nan
    AT  inf%    inf%    -nan
    CT  inf%    inf%    -nan
    GT  inf%    inf%    -nan
    TT  inf%    inf%    -nan
Autonormalization: 3-mers (64 total)
Normalization weights can be found in file: ./CPEB4/seq.autonorm.tsv
Converging on autonormalization solution:
...............................................................................
Final normalization:    Autonormalization: 1-mers (4 total)
    A   inf%    inf%    -nan
    C   inf%    inf%    -nan
    G   inf%    inf%    -nan
    T   inf%    inf%    -nan
Autonormalization: 2-mers (16 total)
    AA  inf%    inf%    -nan
    CA  inf%    inf%    -nan
    GA  inf%    inf%    -nan
    TA  inf%    inf%    -nan
    AC  inf%    inf%    -nan
    CC  inf%    inf%    -nan
    GC  inf%    inf%    -nan
    TC  inf%    inf%    -nan
    AG  inf%    inf%    -nan
    CG  inf%    inf%    -nan
    GG  inf%    inf%    -nan
    TG  inf%    inf%    -nan
    AT  inf%    inf%    -nan
    CT  inf%    inf%    -nan
    GT  inf%    inf%    -nan
    TT  inf%    inf%    -nan
Autonormalization: 3-mers (64 total)

Progress: Step6 - Gene Ontology Enrichment Analysis
Skipping...

Progress: Step7 - Known motif enrichment

Reading input files...
0 total sequences read
1006 motifs loaded
Cache length = 11180
Using hypergeometric scoring
Checking enrichment of 1006 motif(s)
|0%                                    50%                                  100%|
=================================================================================

Illegal division by zero at /software/HOMER/bin/findKnownMotifs.pl line 152.

Progress: Step8 - De novo motif finding (HOMER)

Scanning input files...

!!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!!

Scanning input files...

!!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!!

-blen automatically set to 2
Scanning input files...

!!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!! Use of uninitialized value in numeric gt (>) at /software/HOMER/bin/compareMotifs.pl line 1394. !!! Filtered out all motifs!!! Job finished

motif homer findmotifs.pl

0 answers

No answers yet.

Log in to answer this question.