More posts like this
-
Detecting Inversions from Genome Alignments
written by saamhasan55 3Hello, I have whole genome pairwise alignments generated using Nucmer. The alignment is a table file with chromosome number, starting and end positions of all …
-
Should we remove plasmid sequences for Whole genome Alignment
written by Optimist 19Hello there!! Should we remove plasmid sequences from genome assemblies for Whole Genome alignment? I want to perform Whole genome alignment among 20 bacterial genomes. …
-
tools for MLST analysis
written by hafiz.talhamalik 35is there any tool to perform MLST analysis of bacterial whole genome samples/assembly ??
-
Generate Consensus Sequence from Pairwise Alignment
written by kspata 9Hi All, I am aligning a consensus sequence with a reference genome by pairwise alignment. Is there a tool which can generate a consensus sequence …
-
FASTA file into excel file format?
written by Azhar 5Hi, I have a NCBI fast seq file like >mrna1 gctatatagactgatagctag >mrna2 acgaggctagcggattg for whole Human genome and i want to convert it into excel …
-
Is there any NGS tool which produce long pairwise reads?
written by manetsus 4AFIK, Short sequencing and short pairwise sequencing generated by next-generation-sequencing is common now-a-days and there exists several alignment tools for them. But I want to …
-
How To Compute Dn/Ds From Pairwise Alignment
written by gundalav 38<p>I have a set of sequences (human 5'utr region), with which I already did pairwise alignment against chimp and rat whole genome. So I have …
-
How To Produce An Analysis Report From Blast Output ?
written by pmuench 14<p>Hello, is there a tool for processing the blast output and perform a statistical analysis of the alignment? For example a plot of the position …
-
Finding Protein Sequence Coverage With R Or Python
written by Lakshmi 6<p>Hello,</p> <p>I am trying to find protein sequence coverage after pairwise sequence alignment by using the following formula</p> <p>sequence coverage = (length of aligned residues/length …
-
How To Find All Rna Stems In Genomic Data?
written by None 3<p>I am searching for RNA stems of approx. 10 to 1000 bases. Is there a fast, BLAST-like tool for scanning DNA sequences of, for instance, …
What do you mean with that? You provide too little information for us to answer your question.